Versions

Description

=============================== fuzzysearch =============================== .. image:: https://badge.fury.io/py/fuzzysearch.png :target: http://badge.fury.io/py/fuzzysearch .. image:: https://travis-ci.org/taleinat/fuzzysearch.png?branch=master :target: https://travis-ci.org/taleinat/fuzzysearch .. image:: https://pypip.in/d/fuzzysearch/badge.png :target: https://crate.io/packages/fuzzysearch?version=latest fuzzysearch is useful for finding approximate subsequence matches * Free software: MIT license * Documentation: http://fuzzysearch.rtfd.org. Features -------- * Fuzzy sub-sequence search: Find parts of a sequence which match a given sub-sequence up to a given maximum Levenshtein distance. Example ------- .. code:: python >>> sequence = '''\ GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG GGGATAGG''' >>> subsequence = 'TGCACTGTAGGGATAACAAT' #distance 1 >>> max_distance = 2 >>> from fuzzysearch import find_near_matches_with_ngrams >>> find_near_matches_with_ngrams(subsequence, sequence, max_distance) [Match(start=3, end=24, dist=1)]

Repository

https://github.com/taleinat/fuzzysearch.git

Project Slug

fuzzysearch

Last Built

3 years, 11 months ago failed

Maintainers

Home Page

https://github.com/taleinat/fuzzysearch

Badge

Tags

python

Short URLs

fuzzysearch.readthedocs.io
fuzzysearch.rtfd.io

Default Version

latest

'latest' Version

master