FlowCraft¶

A NextFlow pipeline assembler for genomics.
Overview¶
FlowCraft is an assembler of pipelines written in nextflow for analyses of genomic data. The premisse is simple:
Software are container blocks → Build your lego-like pipeline → Execute it (almost) anywhere.
What is Nextflow¶
If you do not know nextflow, be sure to check it out. It’s an awesome framework based on the dataflow programming model used for building parallelized, scalable and reproducible workflows using software containers. It provides an abstraction layer between the execution and the logic of the pipeline, which means that the same pipeline code can be executed on multiple platforms, from a local laptop to clusters managed with SLURM, SGE, etc. These are quite attractive features since genomic pipelines are increasingly executed on large computer clusters to handle large volumes of data and/or tasks. Moreover, portability and reproducibility are becoming central pillars in modern data science.
What FlowCraft does¶
FlowCraft is a python engine that automatically builds nextflow pipelines
by assembling pre-made ready-to-use components. These components are modular
pieces of software or scripts, such as fastqc
, trimmomatic
, spades
,
etc, that are written for nextflow and have a set of attributes, such as
input and output types, parameters, directives, etc. This modular nature
allows them to be freely connected as long as they respect some basic rules,
such as the input type of a component must match with the output type of
the preceding component. In this way, nextflow processes can be
written only once, and FlowCraft is the magic glue that connects them,
handling the linking and forking of channels automatically. Moreover, each
component is associated with a docker image, which means that there is no
need to install any dependencies at all and all software runs on a
transparent and reliable box. To illustrate:
A linear genome assembly pipeline can be easily built using FlowCraft with the following pipeline string:
trimmomatic fastqc spades
Which will generate all the necessary files to run the nextflow pipeline on any linux system that has nextflow and a container engine.
You can easily add more components to perform assembly polishing, in this case,
pilon
:trimmomatic fastqc spades pilon
If a new assembler comes along and you want to switch that component in the pipeline, its as easy as replacing
spades
(or any other component):trimmomatic fastqc skesa pilon
And you can also fork the output of a component into multiple ones. For instance, we could annotate the resulting assemblies with multiple software:
trimmomatic fastqc spades pilon (abricate | prokka)
Or fork the execution of a pipeline early on to compare different software:
trimmomatic fastqc (spades pilon | skesa pilon)
This will fork the output of fastqc
into spades
and skesa
, and
the pipeline will proceed independently in these two new ‘lanes’.
Directives for each process can be dynamically set when building the pipeline, such as the cpu/RAM usage or the software version:
trimmomatic={'cpus':'4'} fastqc={'version':'0.11.5'} skesa={'memory':'10GB'} pilon (abricate | prokka)
And extra input can be directly inserted in any part of the pipeline. For example, it is possible to assemble genomes from both fastq files and SRR accessions (downloaded from public databases) in a single workflow:
download_reads trimmomatic={'extra_input':'reads'} fastqc skesa pilon
This pipeline can be executed by providing a file with accession numbers
(--accessions
parameter by default) and fastq reads, using the
--reads
parameter defined with the extra_input
directive.
Who is FlowCraft for¶
FlowCraft can be useful for bioinformaticians with varied levels of expertise that need to executed genomic pipelines often and potentially in different platforms. Building and executing pipelines requires no programming knowledge, but familiarization with nextflow is highly recommended to take full advantage of the generated pipelines.
At the moment, the available pre-made processes are mainly focused on bacterial genome assembly simply because that was how we started. However, our goal is to expand the library of existing components to other commonly used tools in the field of genomics and to widen the applicability and usefulness of FlowCraft pipelines.
Why not just write a Nextflow pipeline?¶
In many cases, building a static nextflow pipeline is sufficient for our goals.
However, when building our own pipelines, we often felt the need to add
dynamism to this process, particularly if we take into account how fast new
tools arise and existing ones change. Our biological goals also change over
time and we might need different pipelines to answer different questions.
FlowCraft makes this very easy by having a set of pre-made and ready-to-use
components that can be freely assembled. By using components (fastqc
,
trimmomatic
) as its atomic elements, very complex pielines that take
full advantage of nextflow can be built with little effort. Moreover,
these components have explicit and standardized
input and output types, which means that the addition of new modules does not
require any changes in the existing code base. They just need to take into
account how data will be received by the process and how data may be emitted
from the process, to ensure that it can link with other components.
However, why not both?
FlowCraft generates a complete Nextflow pipeline file, which ca be used as a starting point for your customized processes!
Installation¶
User installation¶
FlowCraft is available as a bioconda package, which already comes with nextflow:
conda install flowcraft
Alternatively, you can install only FlowCraft, via pip:
pip install flowcraft
You will also need a container engine (see Container engine below)
Container engine¶
All components of FlowCraft are executed in docker containers, which means that you’ll need to have a container engine installed. The container engines available are the ones supported by Nextflow:
- Docker,
- Singularity
- Shifter (undocumented)
If you already have any one of these installed, you are good to go. If not, you’ll need to install one. We recommend singularity because it does not require the processes to run on a separate root daemon.
Singularity¶
Singularity is available to download and install here. Make sure that you have singularity v2.5.x or higher. Note that singularity should be installed as root and available on the machine(s) that will be running the nextflow processes.
Important
Singularity is available as a bioconda package. However, conda installs singularity in user space without root privileges, which may prevent singularity images from being correctly downloaded. Therefore it is not recommended that you install singularity via bioconda.
Docker¶
Docker can be installed following the instructions on the website: https://www.docker.com/community-edition#/download. To run docker as anon-root user, you’ll need to following the instructions on the website: https://docs.docker.com/install/linux/linux-postinstall/#manage-docker-as-a-non-root-user
Developer installation¶
If you are looking to contribute to FlowCraft or simply interested in tweaking it, clone the github repository and its submodule and then run setup.py:
git clone https://github.com/assemblerflow/flowcraft.git
cd flowcraft
python3 setup.py install
About¶
FlowCraft is developed by the Molecular Microbiology and Infection Unit (UMMI) at the Instituto de Medicina Molecular Joao Antunes.
This project is licensed under the GPLv3 license. The source code of FlowCraft is available at https://github.com/assemblerflow/flowcraft and the webservice is available at https://github.com/assemblerflow/flowcraft-webapp.
Basic Usage¶
FlowCraft has currently two execution modes, build
and inspect
, that are
used to build and inspect the nextflow pipeline, respectively. However, a
report
mode is also being developed.
Build¶
Assembling a pipeline¶
Pipelines are generated using the build
mode of FlowCraft
and the -t
parameter to specify the components inside quotes:
flowcraft build -t "trimmomatic fastqc spades" -o my_pipe.nf
All components should be written inside quotes and be space separated. This command will generate a linear pipeline with three components on the current working directory (for more features and tips on how pipelines can be built, see the pipeline building section). A linear pipeline means that there are no bifurcations between components, and the input data will flow linearly.
The rationale of how the data flows across the pipeline is simple and intuitive.
Data enters a component and is processed in some way, which may result on the
creation of result files (stored in the results
directory) and reports
files (stored in the reports
directory) (see Results and reports below). If that
component has an output_type
, it will feed the processed data into the
next component (or components) and this will repeated until the end of the
pipeline.
If you are interesting in checking the pipeline DAG tree, open the
my_pipe.html
file (same name as the pipeline with the html extension)
in any browser.

The integrity_coverage
component is a dependency of trimmomatic
, so
it was automatically added to the pipeline.
Important
Not all pipeline configurations will work. You always need to ensure that the output type of a component matches the input type of the next component, otherwise FlowCraft will exit with an error.
Pipeline directory¶
In addition to the main nextflow pipeline file (my_pipe.nf
),
FlowCraft will write several auxiliary files that are necessary for
the pipeline to run. The contents of the directory should look something like
this:
$ ls
bin lib my_pipe.nf params.config templates
containers.config my_pipe.html nextflow.config profiles.config resources.config user.config
You do not have to worry about most of these files. However, the
*.config
files can be modified to change several aspects of the pipeline run
(see Pipeline configuration for more details). Briefly:
params.config
: Contains all the available parameters of the pipeline (see Parameters below). These can be changed here, or provided directly on run-time (e.g.:nextflow run --fastq value
).resources.config
: Contains the resource directives of the pipeline processes, such as cpus, allocated RAM and other nextflow process directives.containers.config
: Specifies the container and version tag of each process in the pipeline.profiles.config
: Contains a number of predefined profiles of executor and container engine.user.config
: Empty configuration file that is not over-written if you build another pipeline in the same directory. Used to set persistent configurations across different pipelines.
Parameters¶
The parameters of the pipeline can be viewed by running the pipeline file
with nextflow
and using the --help
option:
$ nextflow run my_pipe.nf --help
N E X T F L O W ~ version 0.30.1
Launching `my_pipe.nf` [kickass_mcclintock] - revision: 480b3455ba
============================================================
F L O W C R A F T
============================================================
Built using flowcraft v1.2.1.dev1
Usage:
nextflow run my_pipe.nf
--fastq Path expression to paired-end fastq files. (default: fastq/*_{1,2}.*) (default: 'fastq/*_{1,2}.*')
Component 'INTEGRITY_COVERAGE_1_1'
----------------------------------
--genomeSize_1_1 Genome size estimate for the samples in Mb. It is used to estimate the coverage and other assembly parameters andchecks (default: 1)
--minCoverage_1_1 Minimum coverage for a sample to proceed. By default it's setto 0 to allow any coverage (default: 0)
Component 'TRIMMOMATIC_1_2'
---------------------------
--adapters_1_2 Path to adapters files, if any. (default: 'None')
--trimSlidingWindow_1_2 Perform sliding window trimming, cutting once the average quality within the window falls below a threshold (default: '5:20')
--trimLeading_1_2 Cut bases off the start of a read, if below a threshold quality (default: 3)
--trimTrailing_1_2 Cut bases of the end of a read, if below a threshold quality (default: 3)
--trimMinLength_1_2 Drop the read if it is below a specified length (default: 55)
Component 'FASTQC_1_3'
----------------------
--adapters_1_3 Path to adapters files, if any. (default: 'None')
Component 'SPADES_1_4'
----------------------
--spadesMinCoverage_1_4 The minimum number of reads to consider an edge in the de Bruijn graph during the assembly (default: 2)
--spadesMinKmerCoverage_1_4 Minimum contigs K-mer coverage. After assembly only keep contigs with reported k-mer coverage equal or above this value (default: 2)
--spadesKmers_1_4 If 'auto' the SPAdes k-mer lengths will be determined from the maximum read length of each assembly. If 'default', SPAdes will use the default k-mer lengths. (default: 'auto')
All these parameters are specific to the components of the pipeline. However,
the main input parameter (or parameters) of the pipeline is always available.
In this case, since the pipeline started with fastq paired-end files as the
main input, the --fastq
parameter is available. If the pipeline started
with any other input type or with more than one input type, the appropriate
parameters will appear (more information in the raw input types section).
The parameters are composed by their name (adapters
) followed by the ID of
the process it refers to (_1_2
). The IDs can be consulted in the DAG tree
(See Assembling a pipeline). This is done to prevent issues when duplicating
components and, as such, all parameters will be independent between different
components. This
behaviour can be changed when building the pipeline by using the
--merge-params
option (See Merge parameters).
Note
The --merge-params
option of the build
mode will merge all parameters
with identical names (e.g.: --genomeSize_1_1
and --genomeSize_1_5
become simply --genomeSize
) . This is usually more appropriate and useful
in linear pipelines without component duplication.
Providing/modifying parameters¶
These parameters can be provided on run-time:
nextflow run my_pipe.nf --genomeSize_1_1 5 --adapters_1_2 "/path/to/adapters"
or edited in the params.config
file:
params {
genomeSize_1_1 = 5
adapters_1_2 = "path/to/adapters"
}
Most parameters in FlowCraft’s components already come with sensible
defaults, which means that usually you’ll only need to provide a small number
of arguments. In the example above, the --fastq
is the only parameter
required. I have placed fastq files on the data
directory:
$ ls data
sample_1.fastq.gz sample_2.fastq.gz
We’ll need to provide the pattern to the fastq files. This pattern is perhaps a bit confusing at first, but it’s necessary for the correct inference of the paired:
--fastq "data/*_{1,2}.*"
In this case, the pairs are separated by the “_1.” or “_2.” substring, which leads
to the pattern *_{1,2}.*
. Another common nomenclature for paired fastq
files is something like sample_R1_L001.fastq.gz
. In this case, an
acceptable pattern would be *_R{1,2}_*
.
Important
Note the quotes around the fastq path pattern. These quotes are necessary to allow nextflow to resolve the pattern, otherwise your shell might try to resolve it and provide the wrong input to nextflow.
Execution¶
Once you build your pipeline with Flowcraft you have a standard nextflow pipeline ready to run. Therefore, all you need to do is:
nextflow run my_pipe.nf --fastq "data/*_{1,2}.*
Changing executor and container engine¶
The default run mode of an FlowCraft pipeline is to be executed locally
and using the singularity container engine. In nextflow terms, this is
equivalent to have executor = "local"
and singularity.enabled = true
.
If you want to change these settings, you can modify the
nextflow.config
file, or use one of the available profiles in the
profiles.config
file. These profiles provide a combination of common
<executor>_<container_engine>
that are supported by nextflow. Therefore,
if you want to run the pipeline on a cluster with SLURM and shifter, you’ll
just need to specify the `` slurm_shifter`` profile:
nextflow run my_pipe.nf --fastq "data/*_{1,2}.*" -profile slurm_shifter
Common executors include:
slurm
sge
lsf
pbs
Other container engines are:
docker
singularity
shifter
Docker images¶
All components of FlowCraft are executed in containers, which means that
the first time they are executed in a machine, the corresponding image will have
to be downloaded. In the case of docker, images are pulled and stored in
var/lib/docker
by default. In the case of singularity, the
nextflow.config
generated by FlowCraft sets the cache dir for the
images at $HOME/.singularity_cache
. Note that when an image is downloading,
nextflow does not display any informative message, except for singularity where you’ll
get something like:
Pulling Singularity image docker://ummidock/trimmomatic:0.36-2 [cache /home/diogosilva/.singularity_cache/ummidock-trimmomatic-0.36-2.img]
So, if a process seems to take too long to run the first time, it’s probably because the image is being downloaded.
Results and reports¶
As the pipeline runs, processes may write result and report files to the
results
and reports
directories, respectively. For example, the
reports of the pipeline above, would look something like this:
reports
├── coverage_1_1
│ └── estimated_coverage_initial.csv
├── fastqc_1_3
│ ├── FastQC_2run_report.csv
│ ├── run_2
│ │ ├── sample_1_0_summary.txt
│ │ └── sample_1_1_summary.txt
│ ├── sample_1_1_trim_fastqc.html
│ └── sample_1_2_trim_fastqc.html
└── status
├── master_fail.csv
├── master_status.csv
└── master_warning.csv
The estimated_coverage_initial.csv
file contains a very rough coverage
estimation for each sample, the fastqc*
directory contains the html
reports and summary files of FastQC for each sample, and the status
directory contains a log of the status, warnings and fails of each process for
each sample.
The actual results for each process that produces them, are stored in the
results
directory:
results
├── assembly
│ └── spades_1_4
│ └── sample_1_trim_spades3111.fasta
└── trimmomatic_1_2
├── sample_1_1_trim.fastq.gz
└── sample_1_2_trim.fastq.gz
If you are interested in checking the actual environment where the execution
of a particular process occurred for any given sample, you can inspected the
pipeline_stats.txt
file in the root of the pipeline directory. This file
contains rich information about the execution of each process, including
the working directory:
task_id hash process tag status exit start container cpus duration realtime queue %cpu %mem rss vmem
5 7c/cae270 trimmomatic_1_2 sample_1 COMPLETED 0 2018-04-12 11:42:29.599 docker:ummidock/trimmomatic:0.36-2 2 1m 25s 1m 17s - 329.3% 1.1% 1.5 GB 33.3 GB
The hash
column contains the start of the current working directory of that
process. In the example below, the directory would be:
work/7c/cae270*
Inspect¶
FlowCraft has two options (overview
and broadcast
) for inspecting the
progress of a pipeline that is running locally, either in a personal computer
or a server machine. In both cases, the progress of the pipeline will be
continuously updated in real-time.
In a terminal¶
To open inspect in the terminal just write the following command on the folder that the pipeline is running:
flowcraft inspect

overview
is the default behavior of this module, but it can also be called
like this:
flowcraft inspect -m overview
Note
To exit the inspection just type q
or ctrl+c
.
In a browser¶
It is also possible to track the pipeline progress in a browser in any device using the flowcraft web application. To do so, the following command should be run in the folder where the pipeline is running:
flowcraft inspect -m broadcast
This will output an URL to the terminal that can be opened in a browser. This is an example of the screen that is displayed once the url is opened:

Important
This pipeline inspection will be available for anyone via the provided URL,
which means that the URL can be shared with anyone and/or any device with
a browser. However, the inspection section will only be available while
the flowcraft inspect -m broadcast
command is running. Once this command
is cancelled, the data will be erased from the service and the URL will
no longer be available.
Want to know more?¶
Pipeline inspection is the full documentation of the inspect
mode.
Reports¶
The reporting of a FlowCraft pipeline is saved on a JSON file that is stored
in pipeline_reports/pipeline_report.json
. To visualize the reports you’ll just
need to execute the following command in the folder where the pipeline was executed:
flowcraft report
This will output an URL to the terminal that can be opened in a browser. This is an example of the screen that is displayed once the url is opened:

The actual layout and content of the reports will depend on the pipeline you build and it will only provide the information that is directly related to your pipeline components.
Important
This pipeline report will be available for anyone via the provided URL,
which means that the URL can be shared with anyone and/or any device with
a browser. However, the report section will only be available while
the flowcraft report
command is running. Once this command
is cancelled, the data will be erased from the service and the URL will
no longer be available.
Real time reports¶
The reports of any FlowCraft pipeline can be monitored in real-time using the
--watch
option:
flowcraft report --watch
This will output an URL exactly as in the previous section and will render the same reports page with a small addition. In the top right of the screen in the navigation bar, there will be a new icon that informs the user when new reports are available:

Local visualization¶
The FlowCraft report JSON file can also be visualized locally by drag and dropping it into the FlowCraft web application page, currently hosted at http://www.flowcraft.live/reports
Offline visualization¶
The complete FlowCraft report is also available as a standalone HTML file that
can be visualized offline. This HTML file, stored in
pipeline_reports/pipeline_report.html
, can be opened in any modern browser.
Pipeline building¶
FlowCraft offers a few extra features when building pipelines using the
build
execution mode.
Raw input types¶
The first component (or components) you place at the start of the pipeline
determine the raw input type, and the parameter for providing input data.
The input type information is provided in the documentation page of each
component. For instance, if the first component is FastQC, which has an input
type of FastQ
, the parameter for providing the raw input data will be
--fastq
. Here are the currently supported input types and their
respective parameters:
FastQ
:--fastq
Fasta
:--fasta
Accessions
:--accessions
Merge parameters¶
By default, parameters in a FlowCraft pipeline are unique and independent
between different components, even if the parameters have the same name and/or
the components are the same. This allows for the execution of the same software
using different parameters in a single workflow. The params.config
of these
pipelines will look something like:
params {
/*
Component 'trimmomatic_1_2'
--------------------------
*/
adapters_1_2 = 'None'
trimSlidingWindow_1_2 = '5:20'
trimLeading_1_2 = 3
trimTrailing_1_2 = 3
trimMinLength_1_2 = 55
/*
Component 'fastqc_1_3'
---------------------
*/
adapters_1_3 = 'None'
}
Notice that the adapters
parameter occurs twice and can be independently set
in each component.
If you want to override this behaviour, FlowCraft has a --merge-params
option
that merges all parameters with the same name in a single parameter, which is then
equally applied to all components. So, if we generate the pipeline above
with this option:
flowcraft build -t "trimmomatic fastqc" -o pipe.nf --merge-params
Then, the params.config
will become:
params {
adapters = 'None'
trimSlidingWindow = '5:20'
trimLeading = 3
trimTrailing = 3
trimMinLength = 5
}
Forks¶
The output of any component in an FlowCraft pipeline can be forked into two or more components, using the following fork syntax:
trimmomatic fastqc (spades | skesa)

In this example, the output of fastqc
will be fork into two new lanes,
which will proceed independently from each other. In this syntax, a fork is
triggered by the (
symbol (and the corresponding closing )
) and each
lane will be separated by a |
symbol. There is no limitation to the number
of forks or lanes that a pipeline has. For instance, we could add more
components after the skesa
module, including another fork:
trimmomatic fastqc (spades | skesa pilon (abricate | prokka | chewbbaca))

In this example, data will be forked after fastqc
into two new lanes,
processed by spades
and skesa
. In the skesa lane, data will continue
to flow into the pilon
component and its output will fork into three new
lanes.
It is also possible to start a fork at the beggining of the pipeline, which basically means that the pipeline will have multiple starting points. If we want to provide the raw input two multiple process, the fork syntax can start at the beginning of the pipeline:
(seq_typing | trimmomatic fastqc (spades | skesa))

In this case, since both initial components (seq_typing
and
integrity_coverage
) received fastq files as input, the data provided
via the --fastq
parameter will be forked and provided to both processes.
Note
Some components have dependencies which need to be included previously
in the pipeline. For instance, trimmomatic
requires
integrity_coverage
and pilon
requires assembly_mapping
. By
default, FlowCraft will insert any missing dependencies right before
the process, which is why these components appear in the figures above.
Warning
Pay special attention to the syntax of the pipeline string when using forks. However, when unable to parse it, FlowCraft will do its best to inform you where the parsing error occurred.
Directives¶
Several directives with information on cpu usage, RAM, version, etc. can be
specified for each individual component when building the pipeline using the
={}
notation. These
directives are written to the resources.config
and
containers.config
files that are generated in the pipeline directory. You
can pass any of the directives already supported by nextflow (https://www.nextflow.io/docs/latest/process.html#directives),
but the most commonly used include:
cpus
memory
queue
In addition, you can also pass the container
and version
directives
which are parsed by FlowCraft to dynamically change the container and/or
version tag of any process.
Here is an example where we specify cpu usage, allocated memory and container version in the pipeline string:
flowcraft build -t "fastqc={'version':'0.11.5'} \
trimmomatic={'cpus':'2'} \
spades={'memory':'\'10GB\''}" -o my_pipeline.nf
When a directive is not specified, it will assume the default value of the nextflow directive.
Warning
Take special care not to include any white space characters inside the
directives field. Common mistakes occur when specifying directives like
fastqc={'version': '0.11.5'}
.
Note
The values specified in these directives are placed in the
respective config files exactly as they are. For instance,
spades={'memory':'10GB'}"
will appear in the config as
spades.memory = 10Gb
, which will raise an error in nextflow because
10Gb
should be a string. Therefore, if you want a string you’ll need to add
the '
as in this example: spades={'memory':'\'10GB\''}"
. The
reason why these directives are not automatically converted is to allow
the specification of dynamic computing resources, such as
spades={'memory':'{10.Gb*task.attempt}'}"
Extra inputs¶
By default, only the first process (or processes) in a pipeline will receive
the raw input data provided by the user. However, the extra_input
special
directive allows one or more processes to receive input from an additional parameter
that is provided by the user:
reads_download integrity_coverage={'extra_input':'local'} trimmomatic spades
The default main input of this pipeline is a text file with accession numbers
for the reads_download
component. The extra_input
creates
a new parameter, named local
in this example, that allows us to provide
additional input data to the integrity_coverage
component directly:
nextflow run pipe.nf --accessions accession_list.txt --local "fastq/*_{1,2}.*"
What will happen in this pipeline, is that the fastq files provided to the
integrity_coverage
component will be mixed with the ones provided by the
reads_download
component. Therefore, if we provide 10 accessions and 10
fastq samples, we’ll end up with 20 samples being processed by the end of the
pieline.
It is important to note that the extra input parameter expected data compliant with the input type of the process. If files other than fastq files would be provided in the pipeline above, this would result in a pipeline error.
If the extra_input
directive is used on a component that has a different
input type from the first component in the pipeline, it is possible to use
the default
value:
trimmomatic spades abricate={'extra_input':'default'}
In this case, the input type of the first component if fastq and the input
type of abricate
is fasta. The default
value will make available the
default parameter for fasta raw input, which is fasta
:
nextflow run pipe.nf --fastq "fastq/*_{1,2}.*" --fasta "fasta/*.fasta"
Pipeline file¶
Instead of providing the pipeline components via the command line, you can specify them in a text file:
# my_pipe.txt
trimmomatic fastqc spades
And then provide the pipeline file to the -t
parameter:
flowcraft build -t my_pipe.txt -o my_pipe.nf
Pipeline files are usually more readable, particularly when they become more complex. Consider the following example:
integrity_coverage (
spades={'memory':'\'50GB\''} |
skesa={'memory':'\'40GB\'','cpus':'4'} |
trimmomatic fastqc (
spades pilon (abricate={'extra_input':'default'} | prokka) |
skesa pilon (abricate | prokka)
)
)
In addition to be more readable, it is also easier to edit, re-use and share.
Pipeline configuration¶
When a nextflow pipeline is built with FlowCraft, a number of configuration
files are automatically generated in the same directory. They are all imported
at the end of the nextflow.config
file and are sorted by their configuration
role. All configuration files are overwritten if you build another pipeline
in the same directory, with the exception of the user.config
file, which
is meant to be a persistent configuration file.
Parameters¶
The params.config
file includes all available paramenters for the pipeline
and their respective default values. Most of these parameters already contain
sensible defaults.
Resources¶
The resources.config
file includes the majority of the directives provided
for each process, including cpus
and memory
. You’ll note that each
process name has a suffix like _1_1
, which is a unique process identifier
composed of <lane>_<process_number>
. This ensures that even when the same
component is specified multiple times in a pipeline, you’ll still be able to
set directives for each one individually.
Containers¶
The containers.config
file includes the container directive for each
process in the pipeline. These containers are retrieved from dockerhub, if they
do not exist locally yet. You can change the container string to any other
value, but it should point to an image that exist on dockerhub or locally.
Profiles¶
The profiles.config
file includes a set of pre-made profiles with all
possible combinations of executors and container engines. You can add new ones
or modify existing one.
User configutations¶
The user.config
file is configuration file that is not overwritten when a
new pipeline is build in the same directory. It can contain any configuration
that is supported by nextflow and will overwrite all other configuration files.
Pipeline inspection¶
FlowCraft offers an inspect
mode for tracking the progress of a nextflow
pipeline either directly in a terminal (overview
) or by broadcasting information to
the flowcraft web application
(broadcast
).
Note
This mode was design for nextflow pipelines generated by FlowCraft. It should be possible to inspect any nextflow pipeline, provided that the requirements below are met, but compatibility it’s not guaranteed.
How it works: Simply run flowcraft inspect -m <mode>
in the directory
where the pipeline is running. In either run mode, FlowCraft will keep running
(until you cancel it) and continuously update the progress of a pipeline. If
the pipeline is interrupted or fails for some reason, FlowCraft should be able
to correctly reset the inspection automatically when resuming its execution.
Requirements for inspect¶
While the inspect
mode is running, it will parse the information written
into two files that are generated by nextflow:
.nextflow.log
: The log file that is automatically generated by nextflow.trace file
: The trace file that is generated by nextflow when using the-with-trace
option. By default, it searches for thepipeline_stats.txt
file, but this can be changed using the-i
option.
Trace fields¶
FlowCraft parses several fields of the trace file, but only a few are mandatory for its execution. If the trace file does not contain any of the optional fields, that information will simply not appear on the terminal or web app. Nevertheless, to take full advantage of the inspect mode, the following trace fields should be present:
- Mandatory:
tag
: The tag of the nextflow process. Flowcraft assumes that this is a string with only the sample name (e.g.: SampleA). While this is not strictly required, providing strings with other information (e.g.: Running bowtie for sampleA) may result in some inconsistencies in the inspection.task_id
: The task ID is used to skip entries that have already been parsed.
- Optional:
hash
: Used to get the work directory the process execution.cpus
,%cpu
,memory
,rss
,rchar
andwchar
: Used for statistics of computational resources.
Note
Any additional fields present in the trace file are ignored.
Usage¶
flowcraft inspect --help
usage: flowcraft inspect [-h] [-i TRACE_FILE] [-r REFRESH_RATE]
[-m {overview,broadcast}] [-u URL] [--pretty]
optional arguments:
-h, --help show this help message and exit
-i TRACE_FILE Specify the nextflow trace file.
-r REFRESH_RATE Set the refresh frequency for the continuous inspect
functions
-m {overview,broadcast}, --mode {overview,broadcast}
Specify the inspection run mode.
-u URL, --url URL Specify the URL to where the data should be broadcast
--pretty Pretty inspection mode that removes usual reporting
processes.
-i
: Used to specify the path to the trace file that should be parsed. By default, FlowCraft will try to parse thepipeline_stats.txt
file in current working directory.-r
: Sets the time interval in seconds between each parsing of the relevant nextflow files. By default it is set to0.01
.-m
: The inspection mode.overview
is the terminal display whilebroadcast
sends the data to FlowCraft’s web service.-u
: The URL of FlowCraft’s web service. By default it is already set to the main service and you do not need to specify it. It is only useful when the service is running on local host or in other custom instance.--pretty
: By default the inspection shows the progress of all processes in the pipeline. Using this option filters the processes to the most relevant ones of FlowCraft’s pipelines.
Pipeline reports¶
abricate¶
Plot data¶
- Sliding window AMR annotation: Provides annotation of Abricate hits for
each database along the genome. This report component is only available when
the
pilon
component was used downstream ofabricate
.

assembly_mapping¶
Plot data¶
- Data loss chart: Gives a trend of the data loss (in total number of base pairs) across components that may filter this data.

Warnings¶
- Assembly table:
- When the number of contigs exceeds the threshold of 100 contigs per 1.5Mb.
Fails¶
- Assembly table:
- When the assembly size if smaller than 80% or larger than 150% of the expected genome size.
check_coverage¶
Table data¶
- Quality control table:
- Coverage: Estimated coverage based on the number of base pairs and the expected genome size.

Warnings¶
- Quality control table:
- When the enconding and phred score cannot be guessed from the FastQ file(s).
Fails¶
- Quality control table:
- When the sample has lower estimated coverage than the provided coverage threshold.
chewbbaca¶
Table data¶
- Chewbbaca table:
- Table with the summary statistics of ChewBBACA allele calling, including the number of exact matches, inferred loci, loci not found, etc.

fastqc¶
Plot data¶
- Base sequence quality: The average quality score across the read length.

- Sequence quality: Distribution of the mean sequence quality score.

- Base GC content: Distribution of the GC content of each sequence.

- Sequence length: Distribution of the read sequence length.

- Missing data: Normalized count of missing data across the read length.

Warnings¶
- The following FastQC categories will issue a warning when they have a
WARN
flag: - Per base sequence quality.
- Overrepresented sequences.
- The following FastQC categories will issue a warning when do not have a
PASS
flag: - Per base sequence content.
Fails¶
- The following FastQC categories will issue a fail when they have a
FAIL
flag: - Per base sequence quality.
- Overrepresented sequences.
- Sequence length distribution.
- Per sequence GC content.
- The following FastQC categories will issue a fail when the do not have a
PASS
flag: - Per base N content.
- Adapter content.
fastqc_trimmomatic¶
Plot data¶
- Data loss chart: Gives a trend of the data loss (in total number of base pairs) across components that may filter this data.

integrity_coverage¶
Table data¶
- Quality control table:
- Raw BP: Number of raw base pairs from the FastQ file(s).
- Reads: Number of reads in the FastQ file(s)
- Coverage: Estimated coverage based on the number of base pairs and the expected genome size.

Plot data¶
- Data loss chart: Gives a trend of the data loss (in total number of base pairs) across components that may filter this data.

Warnings¶
- Quality control table:
- When the enconding and phred score cannot be guessed from the FastQ file(s).
Fails¶
- Quality control table:
- When the sample has lower estimated coverage than the provided coverage threshold.
mash_dist¶
Plot data¶
- Sliding window Plasmid annotation: Provides annotation of plasmid
hits along the genome assembly. This report component is only available
when the
mash_dist
component is used.

mlst¶
Table data¶
- Typing table:
- MLST species: The inferred species name.
- MLST ST: The inferred sequence type.

pilon¶
Table data¶
- Quality control table:
- Contigs: Number of assembled contigs.
- Assembled BP: Total number of assembled base pairs.

Plot data¶
- Contig size distribution: Distribution of the size of each assembled contig.

- Sliding window coverage and GC content: Provides coverage and GC content metrics along the genome using a sliding window approach and two synchronised charts.

Warnings¶
- Quality control table:
- When the enconding and phred score cannot be guessed from the FastQ file(s).
Fails¶
- Quality control table:
- When the sample has lower estimated coverage than the provided coverage threshold.
process_mapping¶
Table data¶
- Read mapping table:
- Reads: Number reads in the the FastQ file(s).
- Unmapped: Number of unmapped reads
- Mapped 1x: Number of reads that aligned, concordantly and discordantly, exactly 1 time
- Mapped >1x: Number of reads that aligned, concordantly or disconrdantly, more than 1 times
- Overall alignment rate (%): Overall alignment rate

process_skesa¶
Table data¶
- Quality control table:
- Contigs (skesa): Number of assembled contigs.
- Assembled BP: Total number of assembled base pairs.

Warnings¶
- Assembly table:
- When the number of contigs exceeds the threshold of 100 contigs per 1.5Mb.
Fails¶
- Assembly table:
- When the assembly size if smaller than 80% or larger than 150% of the expected genome size.
process_spades¶
Table data¶
- Quality control table:
- Contigs (spades): Number of assembled contigs.
- Assembled BP: Total number of assembled base pairs.

Warnings¶
- Assembly table:
- When the number of contigs exceeds the threshold of 100 contigs per 1.5Mb.
Fails¶
- Assembly table:
- When the assembly size if smaller than 80% or larger than 150% of the expected genome size.
process_viral_assembly¶
Table data¶
- Quality control table:
- Contigs (SPAdes): Number of assembled contigs.
- Assembled BP (SPAdes): Total number of assembled base pairs.
- ORFs: Number of complete ORFs in the assembly.
- Contigs (MEGAHIT): Number of assembled contigs.
- Assembled BP (MEGAHIT): Total number of assembled base pairs.

Fails¶
- Assembly table:
- When the assembly size if smaller than 80% or larger than 150% of the expected genome size.
Components¶
These are the currently available FlowCraft components with a short description of their tasks. For a more detailed information, follow the links of each component.
Download¶
- reads_download: Downloads reads from the SRA/ENA public databases from a list of accessions.
- fasterq_dump: Downloads reads from the SRA public databases
from a list of accessions, using
fasterq-dump
.
Reads Quality Control¶
- check_coverage: Estimates the coverage for each sample and filters FastQ files according to a specified minimum coverage threshold.
- fastqc: Runs FastQC on paired-end FastQ files.
- fastqc_trimmomatic: Runs Trimmomatic on paired-end FastQ files informed by the FastQC report.
- filter_poly: Runs PrinSeq on paired-end FastQ files to remove low complexity sequences.
- integrity_coverage: Tests the integrity of the provided FastQ files, provides the option to filter FastQ files based on the expected assembly coverage and provides information about the maximum read length and sequence encoding.
- trimmomatic: Runs Trimmomatic on paired-end FastQ files.
- downsample_fastq: Subsamples fastq files up to a target coverage depth.
Assembly¶
- megahit: Assembles metagenomic paired-end FastQ files using megahit.
- metaspades: Assembles metagenomic paired-end FastQ files using metaSPAdes.
- skesa: Assembles paired-end FastQ files using skesa.
- spades: Assembles paired-end FastQ files using SPAdes.
Post-assembly¶
- pilon: Corrects and filters assemblies using Pilon.
- process_skesa: Processes the assembly output from Skesa and performs filtering base on quality criteria of GC content k-mer coverage and read length.
- process_spades: Processes the assembly output from Spades and performs filtering base on quality criteria of GC content k-mer coverage and read length.
Annotation¶
Distance Estimation¶
- mash_dist: Executes mash distance against a reference index plasmid database and generates a JSON for pATLAS. This component calculates pairwise distances between sequences (one from the database and the query sequence). However if a different database is provided it can use mash dist for other purposes.
- mash_screen: Performs mash screen against a reference index plasmid database and generates a JSON input file for pATLAS. This component searches for containment of a given sequence in read sequencing data. However if a different database is provided it can use mash screen for other purposes.
- fast_ani: Performs pairwise comparisons between fastas,
given a multifasta as input for fastANI. It will split the multifasta into single fastas that will then be provided as a matrix. The output will be the all pairwise comparisons that pass the minimum of 50 aligned sequences with a default length of 200 bp.
- mash_sketch_fasta: Performs mash sketch for fasta files.
- mash_sketch_fastq: Performes mash sketch for fastq files.
Mapping¶
- assembly_mapping: Performs a mapping procedure of FastQ files into a their assembly and performs filtering based on quality criteria of read coverage and genome size.
- bowtie: Align short paired-end sequencing reads to long reference sequences
- mapping_patlas: Performs read mapping and generates a JSON input file for pATLAS.
- remove_host: Performs read mapping with bowtie2 against the target host genome (default hg19) and removes the mapping reads
- retrieve_mapped: Retrieves the mapped reads of a previous bowtie2 mapping process.
Taxonomic Profiling¶
- kraken: Performs taxonomic identification with kraken on FastQ files (minikrakenDB2017 as default database)
- kraken2: Performs taxonomic identification with kraken2 on FastQ files (minikraken2_v1_8GB as default database)
- midas_species: Performs taxonomic identification on FastQ files at the species level with midas (requires database)
Typing¶
- chewbbaca: Performs a core-genome/whole-genome Multilocus Sequence Typing analysis on an assembly using ChewBBACA.
- metamlst: Checks the Sequence Type of metagenomic reads using Multilocus Sequence Typing.
- mlst: Checks the Sequence Type of an assembly using Multilocus Sequence Typing.
- patho_typing: In silico pathogenic typing from raw illumina reads.
- seq_typing: Determines the type of a given sample from a set of reference sequences.
- sistr: Serovar predictions from whole-genome sequence assemblies by determination of antigen gene and cgMLST gene alleles.
- momps: Multi-locus sequence typing for Legionella pneumophila from assemblies and reads.
General orientation¶
Codebase structure¶
The most important elements of FlowCraft’s directory structure are:
generator
:components
: Contains theProcess
classes for each componenttemplates
: Contains the nextflow jinja template files for each componentengine.py
: The engine of FlowCraft that builds the pipelineprocess.py
: Contains the abstractProcess
class that is inherited- by all component classes
pipeline_parser.py
: Functions that parse and check the pipeline stringrecipe.py
: Class responsible for creating recipes
templates
: A git submodule of the templates repository that contain the template scripts for the components.
Code style¶
- Style: the code base of flowcraft should adhere (the best it can) to the PEP8 style guidelines.
- Docstrings: code should be generally well documented following the numpy docstring style.
- Quality: there is also an integration with the codacy service to evaluate code quality, which is useful for detecting several coding issues that may appear.
Testing¶
Tests are performed using pytest and the source files are stored in the
flowcraft/tests
directory. Tests must be executed on the root directory
of the repository
Documentation¶
Documentation source files are stored in the docs
directory. The general
configuration file is found in docs/conf.py
and the entry
point to the documentation is docs/index.html
.
Process creation guidelines¶
Basic process creation¶
The addition of a new process to FlowCraft requires three main steps:
- Create process template: Create a jinja2 template in
flowcraft.generator.templates
with the nextflow code. - Create Process class: Create a
Process
subclass inflowcraft.generator.process
with information about the process (e.g., expected input/output, secondary inputs, etc.).
Create process template¶
First, create the nextflow template that will be integrated into the pipeline
as a process. This file must be placed in flowcraft.generator.templates
and have the .nf
extension. In order to allow the template to be
dynamically added to a pipeline file, we use the jinja2 template language to
substitute key variables in the process, such as input/output channels.
An example created as a my_process.nf
file is as follows:
some_channel_{{ pid }} = Channel.value(params.param1{{ param_id}})
other_channel_{{ pid }} = Channel.fromPath(params.param2{{ param_id}})
process myProcess_{{ pid }} {
{% include "post.txt" ignore missing %}
publishDir "results/myProcess_{{ pid }}", pattern: "*.tsv"
input:
set sample_id, <data> from {{ input_channel }}
val x from some_channel_{{ pid }}
file y from other_channel_{{ pid }}
val direct_from_parms from Channel.value(params.param3{{param_id}}
// The output is optional
output:
set sample_id, <data> into {{ output_channel }}
{% with task_name="abricate" %}
{%- include "compiler_channels.txt" ignore missing -%}
{% endwith %}
"""
<process code/commands>
"""
}
{{ forks }}
The fields surrounded by curly brackets are jinja placeholders that will be dynamically substituted when building the pipeline. They will ensure that the processes and potential forks correctly link with each other and that channels are unique and correctly linked. This example contains all placeholder variables that are currently supported by FlowCraft.
{{pid}}¶
Used as a unique process identifier that prevent issues
from process and channel duplication in the pipeline. Therefore, is should be
appended to each process and channel name as _{{ pid }}
(note the underscore):
some_channel_{{ pid }}
process myProcess_{{ pid }}
{{param_id}}¶
Same as the {{ pid }}, but sets the identified for nextflow params
. It should
be appended to each param
as {{ param_id }}
. This will allow parameters
to be specific to each component in the pipeline:
Channel.value(params.param1{{ param_id}})
Note that the parameters used in the template, should also be defined in the Process class params attribute (see Parameters).
{% include “post.txt” %}¶
Inserts beforeScript
and afterScript
statements to the process that
sets environmental variables and a series of dotfiles for the process to
log their status, warnings, fails and reports (see Dotfiles for
more information). It also includes scripts for sending requests to
REST APIs (only when certain pipeline parameters are used).
{{input_channel}}¶
All processes must include one and only one input channel. In most cases,
this channel should be defined with a two element tuple that contains the
sample ID and then the actual data file/stream. We suggest the sample ID
variable to be named sample_id
as a standard. If other name variable name
is specified and you include the compiler_channels.txt
in the process,
you’ll need to change the sample ID variable (see Sample ID variable).
{{output_channel}}¶
Terminal processes may skip the output channel entirely. However, if you want
to link the main output of this process with subsequent ones, this placeholder
must be used only once. Like in the input channel, this channel should
be defined with a two element tuple with the sample ID and the data. The
sample ID must match the one specified in the input_channel
.
{% include “compiler_channels.txt %}¶
This will include the special channels that will compile the status/logging of the processes throughout the pipeline. You must include the whole block (see Status channels):
{% with task_name="abricate" %}
{%- include "compiler_channels.txt" ignore missing -%}
{% endwith %}
{{forks}}¶
Inserts potential forks of the main output channel. It is mandatory if
the output_channel
is set.
Complete example¶
As an example of a complete process, this is the template of spades.nf
:
IN_spades_opts_{{ pid }} = Channel.value([params.spadesMinCoverage{{ param_id }},params.spadesMinKmerCoverage{{ param_id }}])
IN_spades_kmers_{{pid}} = Channel.value(params.spadesKmers{{ param_id }})
process spades_{{ pid }} {
// Send POST request to platform
{% include "post.txt" ignore missing %}
tag { fastq_id + " getStats" }
publishDir 'results/assembly/spades/', pattern: '*_spades.assembly.fasta', mode: 'copy'
input:
set fastq_id, file(fastq_pair), max_len from {{ input_channel }}.join(SIDE_max_len_{{ pid }})
val opts from IN_spades_opts_{{ pid }}
val kmers from IN_spades_kmers_{{ pid }}
output:
set fastq_id, file('*_spades.assembly.fasta') optional true into {{ output_channel }}
set fastq_id, val("spades"), file(".status"), file(".warning"), file(".fail") into STATUS_{{ pid }}
file ".report.json"
script:
template "spades.py"
}
{{ forks }}
Create Process class¶
The process class will contain the information that FlowCraft
will use to build the pipeline and assess potential conflicts/dependencies
between process. This class should be created in one the category files in the
flowcraft.generator.components
module (e.g.: assembly.py
). If
the new component does not fit in any of the existing categories, create a
new one that imports flowcraft.generator.process.Process
and add
your new class. This class should inherit from the
Process
base
class:
class MyProcess(Process):
def __init__(self, **kwargs):
super().__init__(**kwargs)
self.input_type = "fastq"
self.output_type = "fasta"
This is the simplest working example of a process class, which basically needs
to inherit the parent class attributes (the super
part).
Then we only need to define the expected input
and output types of the process. There are no limitations to the
input/output types.
However, a pipeline will only build successfully when all processes correctly
link the output with the input type.
Depending on the process, other attributes may be required:
- Parameters: Parameters provided by the user to be used in the process.
- Secondary inputs: Channels created from parameters provided by the user.
- Secondary Link start and Link end: Secondary links that connect secondary information between two processes.
- Dependencies: List of other processes that may be required for the current process.
- Directives: Default information for RAM/CPU/Container directives and more.
Add to available components¶
Contrary to previous implementation (version <= 1.3.1), the available components
are now retrieved automatically by FlowCraft and there is no need to add the
process to any dictionary (previous process_map
). In order for the component
to be accessible to flowcraft build
the process template name in
snake_case
must match the process class in CamelCase
. For instance,
if the process template is named my_process.nf
, the process class must
be MyProcess
, then the FlowCraft will be able to automatically add it to the
list of available components.
Note
Note that the template string does not include the .nf
extension.
Process attributes¶
This section describes the main attributes of the
Process
class: what they
do and how do they impact the pipeline generation.
Input/Output types¶
The input_type
and
output_type
attributes
set the expected type of input and output of the process. There are no
limitations to the type of input/output that are provided. However, processes
will only link when the output of one process matches the input of the
subsequent process (unless the
ignore_type
attribute is set
to True
). Otherwise, FlowCraft will raise an exception stating that
two processes could not be linked.
Note
The input/ouput types that are currently used are fastq
, fasta
.
Parameters¶
The params
attribute sets
the parameters that can be used by the process. For each parameter, a default
value and a description should be provided. The default value will be set
in the params.config
file in the pipeline directory and the description
will be used to generated the custom help message of the pipeline:
self.params = {
"genomeSize": {
"default": 2.1,
"description": "Expected genome size (default: params.genomeSiz)
},
"minCoverage": {
"default": 15,
"description": "Minimum coverage to proceed (default: params.minCoverage)"
}
}
These parameters can be simple values that are not feed into any channel, or can be automatically set to a secondary input channel via Secondary inputs (see below).
They can be specified when running the pipeline like any nextflow parameter
(e.g.: --genomeSize 5
) and used in the nextflow process as usual
(e.g.: params.genomeSize
).
Note
These pairs are then used to populate the params.config
file that is
generated in the pipeline directory. Note that the values are replaced
literally in the config file. For instance, "genomeSize": 2.1,
will appear
as genomeSize = 2.1
, whereas "adapters": "'None'"
will appear as
adapters = 'None'
. If you want a value to appear as a string, the double
and single quotes are necessary.
Secondary inputs¶
Warning
The secondary_inputs
attribute has been deprecated since v1.2.1.
Instead, specify the secondary channels directly in the nextflow template
files.
Any process can receive one or more input channels in addition to the main
channel. These are particularly useful when the process needs to receive
additional options from the parameters
scope of nextflow.
These additional inputs can be specified via the
secondary_inputs
attribute,
which should store a list of dictionaries (a dictionary for each input). Each dictionary should
contains a key:value pair with the name of the parameter (params
) and the
definition of the nextflow channel (channel
). Consider the example below:
self.secondary_inputs = [
{
"params": "genomeSize",
"channel": "IN_genome_size = Channel.value(params.genomeSize)"
},
{
"params": "minCoverage",
"channel": "IN_min_coverage = Channel.value(params.minCoverage)"
}
]
This process will receive two secondary inputs that are given by the
genomeSize
and minCoverage
parameters. These should be also specified
in the params
attribute
(See Parameters above).
For each of these parameters, the dictionary
also stores how the channel should be defined at the beginning of the pipeline
file. Note that this channel definition mentions the parameters (e.g.
params.genomeSize
). An additional best practice for channel definition
is to include one or more sanity checks to ensure that the provided arguments
are correct. These checks can be added in the nextflow template file, or
literally in the channel
string:
self.secondary_inputs = [
{
"params": "genomeSize",
"channel":
"IN_genome_size = Channel.value(params.genomeSize)"
"map{it -> it.toString().isNumber() ? it : exit(1, \"The genomeSize parameter must be a number or a float. Provided value: '${params.genomeSize}'\")}"
}
Extra input¶
The extra_input
attribute
is mostly a user specified directive that allows the injection of additional
input data from a parameter into the main input channel of the process.
When a pipeline is defined as:
process1 process2={'extra_input':'var'}
FlowCraft will expose a new var
parameter, setup an extra input
channel and mix it with process2
main input channel. A more detailed
explanation follows below.
First, FlowCraft will create a nextflow channel from the parameter name
provided via the extra_input
directive. The channel string will depend
on the input type of the process (this string is fetched from the
RAW_MAPPING
attribute).
For instance, if the input type of
process2
is fastq
, the new extra channel will be:
IN_var_extraInput = Channel.fromFilePairs(params.var)
Since the same extra input parameter may be used by more than one process,
the IN_var_extraInput
channel will be automatically forked into the
final destination channels:
// When there is a single destination channel
IN_var_extraInput.set{ EXTRA_process2_1_2 }
// When there are multiple destination channels for the same parameter
IN_var_extraInput.into{ EXTRA_process2_1_2; EXTRA_process3_1_3 }
The destination channels are the ones that will be actually mixed with the main input channels:
process process2 {
input:
(...) main_channel.mix(EXTRA_process2_1_2)
}
In these cases, the processes that receive the extra input will process the
data provided by the preceding channel AND by the parameter. The data
provided via the extra input parameter does not have to wait for the
main_channel
, which means that they can run in parallel, if there are
enough resources.
Compiler¶
The compiler
attribute
allows one or more channels of the process to be fed into a compiler process
(See Compiler processes). These are special processes that collect
information from one or more processes to execute a given task. Therefore,
this parameter can only be used when there is an appropriate compiler process
available (the available compiler processes are set in the
compilers
dictionary). In order to
provide one or more channels to a compiler process, simply add a key:value to the
attribute, where the key is the id of the compiler process present in the
compilers
dictionary and the value
is the list of channels:
self.compiler["patlas_consensus"] = ["mappingOutputChannel"]
Link start¶
The link_start
attribute
stores a list of strings of channel names that can be used as secondary
channels in the pipeline (See the Secondary links between process section).
By default, this attribute contains the main output channel, which means
that every process can fork the main channel to one or more receiving
processes.
Link end¶
The link_end
attribute
stores a list of dictionaries with channel names that are meant to be
received by the process as secondary channel if the corresponding
Link start exists in the pipeline. Each dictionary in this list will define
one secondary channel and requires two key:value pairs:
self.link_end({
"link": "SomeChannel",
"alias": "OtherChannel")
})
If another process exists in the pipeline with
self.link_start.extend(["SomeChannel"])
, FlowCraft will automatically
establish a secondary channel between the two processes. If there are multiple
processes receiving from a single one, the channel from the later will
for into any number of receiving processes.
Dependencies¶
If a process depends on the presence of one or more processes upstream in the
pipeline, these can be specific via the
dependencies
attribute.
When building the pipeline if at least one of the dependencies is absent,
FlowCraft will raise an exception informing of a missing dependency.
Directives¶
The directives
attribute
allows for information about cpu/RAM usage and container to be specified
for each nextflow process in the template file. For instance, considering
the case where a Process
has a template with two nextflow processes:
process proc_A_{{ pid }} {
// stuff
}
process proc_B_{{ pid }} {
// stuff
}
Then, information about each process can be specified individually in the
directives
attribute:
class myProcess(Process):
(...)
self.directives = {
"proc_A": {
"cpus": 1
"memory": "4GB"
},
"proc_B": {
"cpus": 4
"container": "my/container"
"version": "1.0.0"
}
}
The information in this attribute will then be used to build the
resources.config
(containing the information about cpu/RAM) and
containers.config
(containing the container images) files. Whenever a
directive is missing, such as the container
and version
from proc_A
and memory
from proc_B
, nothing about them will be written into the
config files and they will use the default pipeline values:
cpus
:1
memory
:1GB
container
: flowcraft_base image
Ignore type¶
The ignore_type
attribute,
controls whether a match between the input of the current process and the
output of the previous one is enforced or not. When there are multiple
terminal processes that fork from the main channel, there is no need to
enforce the type match and in that case this attribute can be set to False
.
Process ID¶
The process ID, set via the
pid
attribute, is an
arbitrarily and incremental number that is awarded to each process depending
on its position in the pipeline. It is mainly used to ensure that there are
no duplicated channels even when the same process is used multiple times
in the same pipeline.
Template¶
The template
attribute
is used to fetch the jinja2 template file that corresponds to the current
process. The path to the template file is determined as follows:
join(<template directory>, template + ".nf")
Status channels¶
The status channels are special channels dedicated to passing information regarding the status, warnings, fails and logging from each process (see Dotfiles for more information). They are used only when the nextflow template file contains the appropriate jinja2 placeholder:
output:
{% with task_name="<nextflow_template_name>" %}
{%- include "compiler_channels.txt" ignore missing -%}
{% endwith %}
By default,
every Process
class contains a
status_channels
list
attribute that contains the
template
string:
self.status_channels = ["STATUS_{}".format(template)]
If there is only one nextflow process in the template and the task_name
variable in the template matches the
template
attribute, then
it’s all automatically set up.
If the template file contains more than one nextflow process definition, multiple placeholders can be provided in the template:
process A {
(...)
output:
{% with task_name="A" %}
{%- include "compiler_channels.txt" ignore missing -%}
{% endwith %}
}
process B {
(...)
output:
{% with task_name="B" %}
{%- include "compiler_channels.txt" ignore missing -%}
{% endwith %}
}
In this case, the
status_channels
attribute
would need to be changed to:
self.status_channels = ["A", "B"]
Sample ID variable¶
In case you change the standard nextflow variable that stores the sample ID
in the input of the process (sample_id
), you also need to change it for
the compiler_channels
placeholder:
process A {
input:
set other_id, data from {{ input_channel }}
output:
{% with task_name="B", sample_id="other_id" %}
{%- include "compiler_channels.txt" ignore missing -%}
{% endwith %}
}
Advanced use cases¶
Compiler processes¶
Compilers are special processes that collect data from one or more processes and perform a given task with that compiled data. They are automatically included in the pipeline when at least one of the source channels is present. In the case there are multiple source channels, they are merged according to a specified operator.
Creating a compiler process¶
The creation of the compiler process is simpler than that of a regular process but follows the same three steps.
Create a nextflow template file in
flowcraft.generator.templates
:process fullConsensus { input: set id, file(infile_list) from {{ compile_channels }} output: <output channels> script: """ <commands/code/template> """ }
The only requirement is the inclusion of a compiler_channels
jinja
placeholder in the main input channel.
Create a Compiler class in the
flowcraft.generator.process
module:class PatlasConsensus(Compiler): def __init__(self, **kwargs): super().__init__(**kwargs)
This class must inherit from
Compiler
and does not require any
more changes.
3. Map the compiler template file to the class in
compilers
attribute:
self.compilers = {
"patlas_consensus": {
"cls": pc.PatlasConsensus,
"template": "patlas_consensus",
"operator": "join"
}
}
Each compiler should contain a key:value entry. The key is the compiler
id that is then specified in the compiler
attribute of the component classes. The value is a json/dict object that
species the compiler class in the cls
key, the template string in the
template
string and the operator used to join the channels into the
compiler via the operator
key.
How a compiler process works¶
Consider the case where you have a compiler process named compiler_1
and
two processes, process_1
and process_2
, both of which feed a single
channel to compiler_1
. This means that the class definition of these
processes include:
class Process_1(Process):
(...)
self.compiler["compiler_1"] = ["channel1"]
class Process_2(Process):
(...)
self.compiler["compiler_1"] = ["channel2"]
If a pipeline is built with at least one of these process, the compiler_1
process will be automatically included in the pipeline. If more than one
channel is provided to the compiler, they will be merged with the specified
operator:
process compiler_1 {
input:
set sample_id, file(infile_list) from channel2.join(channel1)
}
This will allow the output of multiple separate process to be processed by a single process in the pipeline, and it automatically adjusts according to the channels provided to the compiler.
Secondary links between process¶
In some cases, it might be necessary to perform additional links between two or more processes. For example, the maximum read length might be gathered in one process, and that information may be required by a subsequent process. These secondary channels allow this information to be passed between theses channels.
These additional links are called secondary channels and they may be explicitly or implicitly declared.
Explicit secondary channels¶
To create an explicit secondary channel, the origin or source of this channel must be declared in the nextflow process that sends it:
// secondary channels can be created inside the process
output:
<main output> into {{ output_channel }}
<secondary output> into SIDE_max_read_len_{{ pid }}
// or outside
SIDE_phred_{{ pid }} = Channel.create()
Then, we add the information that this process has a secondary channel start
via the link_start
list attribute in the corresponding
flowcraft.generator.process.Process
class:
class MyProcess(Process):
(...)
self.link_start.extend(["SIDE_max_read_len", "SIDE_phred"])
Notice that we extend the link_start
list, instead of simply assigning.
This is because all processes already have the main channel as an implicit
link start (See Implicit secondary channels).
Now, any process that is executed after this one can receive this secondary channel.
For another process to receive this channel, it will be necessary to add this
information to the process class(es) via the link_end
list attribute:
class OtherProcess(Process):
(...)
self.link_end.append({
"link": "SIDE_phred",
"alias": "OtherName"
})
Notice that now we append a dictionary with two key:values. The first, link must match a string from the link_start list (in this case, SIDE_phred). The second, alias, will be the channel name in the receiving process nextflow template (which can be the same as the link value).
Now, we only need to add the secondary channel to the nextflow template, as in the example below:
input:
<main_input> from {{ input_channel }}.mix(OtherName_{{ pid}})
Implicit secondary channels¶
By default, the main output of the channels is declared as a secondary channel
start. This means that any process can receive the main output channel as a
a secondary channel of a subsequent process. This can be useful in situations
were a post-assembly process (has assembly
as expected input and output)
needs to receive the last channel with fastq files:
class AssemblyMapping(Process):
(...)
self.link_end.append({
"link": "MAIN_fq",
"alias": "_MAIN_assembly"
})
In this example, the AssemblyMapping
process will receive a secondary
channel with from the last process that output fastq files into a channel
called _MAIN_assembly
. Then, this channel is received in the nextflow
template like this:
input:
<main input> from {{ input_channel }}.join(_{{ input_channel }})
Implicit secondary channels can also be used to fork the last output channel into multiple terminal processes:
class Abricate(Process):
(...)
self.link_end.append({
"link": "MAIN_assembly",
"alias": "MAIN_assembly"
})
In this case, since MAIN_assembly
is already the prefix of the main
output channel of this process, there is no need for changes in the process
template:
input:
<main input> from {{ input_channel }}
Template creation guidelines¶
Though none of these guidelines are mandatory nor required, their usage is highly recommended for several reasons:
- Consistency in the outputs of the templates throughout the pipeline, particularly the status and report dotfiles (see Dotfiles section);
- Debugging purposes;
- Versioning;
- Proper documentation of the template scripts.
Preface header¶
After the script shebang, a header with a brief description of the purpose and
expected inputs and outputs should be provided. A complete example of such
description can be viewed in flowcraft.templates.integrity_coverage
.
Purpose¶
Purpose section contains a brief description of the script’s objective. E.g.:
Purpose
-------
This module is intended parse the results of FastQC for paired end FastQ \
samples.
Expected input¶
Expected input section contains a description of the variables that are provided to the main function of the template script. These variables are defined in the input channels of the process in which the template is supposed to be executed. E.g.:
Expected input
--------------
The following variables are expected whether using NextFlow or the
:py:func:`main` executor.
- ``mash_output`` : String with the name of the mash screen output file.
- e.g.: ``'sortedMashScreenResults_SampleA.txt'``
This means that the process that will execute this channel will have the input defined as:
input:
file(mash_output) from <channel>
Generated output¶
Generated output section contains a description of the output files that the template script is intended to generated. E.g.:
Generated output
----------------
The generated output are output files that contain an object, usually a string.
- ``fastqc_health`` : Stores the health check for the current sample. If it
passes all checks, it contains only the string 'pass'. Otherwise, contains
the summary categories and their respective results
These can then be passed to the output channel(s) in the nextflow process:
output:
file(fastqc_health) into <channel>
Note
Since templates can be re-used by multiple processes, not all generated outputs need to be passed to output channels. Depending on the job of the nextflow process, it may catch none or all of the output files generated by the template.
Versioning and logging¶
FlowCraft has a specific logger
(get_logger()
) and
versioning system that can be imported from
flowcraft.templates.flowcraft_utils
:
# the module that imports the logger and the decorator class for versioning
# of the script itself and other software used in the script
from flowcraft_utils.flowcraft_base import get_logger, MainWrapper
Logger¶
A logger function is also required to add logs to the script. The logs
are written to the .command.log
file in the work directory of each process.
First, the logger must be called, for example, after the imports as follows:
logger = get_logger(__file__)
Then, it may be used at will, using the default logging levels . E.g.:
logger.debug("Information tha may be important for debugging")
logger.info("Information related to the normal execution steps")
logger.warning("Events that may require the attention of the developer")
logger.error("Module exited unexpectedly with error:\\n{}".format(
traceback.format_exc()))
MainWrapper decorator¶
This MainWrapper
class decorator allows the program to fetch information on the script version,
build and template name. For example:
# This can also be declared after the imports
__version__ = "1.0.0"
__build__ = "15012018"
__template__ = "process_abricate-nf"
The MainWrapper
should decorate the main function of the script.
E.g.:
@MainWrapper
def main():
#some awesome code
...
Besides searching for the script’s version, build and template name this decorator
will also search for a specific set of functions that start with the
substring __get_version
. For example:
def __get_version_fastqc():
try:
cli = ["fastqc", "--version"]
p = subprocess.Popen(cli, stdout=PIPE, stderr=PIPE)
stdout, _ = p.communicate()
version = stdout.strip().split()[1][1:].decode("utf8")
except Exception as e:
logger.debug(e)
version = "undefined"
# Note that it returns a dictionary that will then be written to the .versions
# dotfile
return {
"program": "FastQC",
"version": version,
# some programs may also contain build.
}
These functions are used to fetch the version, name and other relevant information from third-party software and the only requirement is that they return a dictionary with at least two key:value pairs:
program
: String with the name of the program.version
: String with the version of the program.
For more information, refer to the
build_versions()
method.
Nextflow .command.sh¶
When these templates are used as a Nextflow template
they are executed as a .command.sh
file in the work directory of each
process. In this case, we recommended the inclusion of
an if statement to parse the arguments sent from nextflow to the python
template. For example, imagine we have a path to a file name to pass as
argument between nextflow and the required template:
# code check for nextflow execution
if __file__.endswith(".command.sh"):
FILE_NAME = '$Nextflow_file_name'
# logger output can also be included here, for example:
logger.debug("Running {} with parameters:".format(
os.path.basename(__file__)))
logger.debug("FILE_NAME: {}".format(FILE_NAME))
Then, we could use this variable as the argument of a function, such as:
def main(FILE_NAME):
#some awesome code
...
This way, we can use this function with nextflow arguments or without them, as is the case when the templates are used as standalone modules.
Recipe creation guidelines¶
Recipes are pre-made pipeline strings that may be associated with specific parameters and directives and are used to rapidly build a certain type of pipeline.
Instead of building a pipeline like:
-t "integrity_coverage fastqc_trimmomatic fastqc spades pilon"
The user simply can specific a recipe with that pipeline:
-r assembly
Recipe creation¶
The creation of new recipes is a very simple and straightforward process.
You need to create a new file in the flowcraft/generator/recipes
folder
with any name and create a basic class with three attributes:
try:
from generator.recipe import Recipe
except ImportError:
from flowcraft.generator.recipe import Recipe
class Innuca(Recipe):
def __init__(self):
super().__init__()
# Recipe name
self.name = "innuca"
# Recipe pipeline
self.pipeline_str = <pipeline string>
# Recipe parameters and directives
self.directives = { <directives> }
And that’s it! Now there is a new recipe available with the innuca
name and
we can build this pipeline using the option -r innuca
.
Name¶
This is the name of the recipe, which is used to make a match with the recipe
name provided by the user via the -r
option.
Pipeline_str¶
The pipeline string as if provided via the -t
option.
Directives¶
A dictionary containing the parameters and directives for each process in the pipeline string. Setting this attribute is optional and components that are not specified here will assume their default values. In general, each element in this dictionary should have the following format:
self.directives = {
"component_name": {
"params": {
"paramA": "value"
},
"directives": {
"directiveA": "value"
}
}
}
This will set the provided parameters and directives to the component, but it is possible to provide only one.
A more concrete example of a real component and directives follows:
self.pipeline_str = "integrity_coverage fastqc"
# Set parameters and directives only for integrity_coverage
# and leave fastqc with the defaults
self.directives = {
"integrity_coverage": {
"params": {
"minCoverage": 20
},
"directives": {
"memory": "1GB"
}
}
}
Duplicate components¶
In some cases, the same component may be present multiple times in the pipeline
string of a recipe. In these cases, directives can be assigned to each individual
component by adding a #<id>
suffix to the component:
self.pipeline_str = "integrity_coverage ( trimmomatic spades#1 | spades#2)"
self.directives = {
"spades#1": {
"directives": {
"memory": "10GB"
}
},
"spades#2": {
"directives": {
"version": "3.7.0"
}
}
}
Docker containers guidelines¶
All FlowCraft components require a docker container in order to be executed,
thus if a new component is added, a docker image should be added as well and
uploaded to
.. _docker hub: https://hub.docker.com/ in order to be available to pull in
other machines. Although this can be done in any personal
repository, we recommend that this docker images are added to an already
existing .. _FlowCraft github repository: https://github.com/assemblerflow/docker-imgs
(called here Official
) so that docker builds can be automated with github
integration. Also, the centralization of all images will allow other
contributors to easily access and edit these containers instead of forking from
one side to another every time a container needs to be changed/updated.
Official FlowCraft Docker images¶
Writing docker images¶
Official FlowCraft Docker images are available in .. _this github repository: https://github.com/assemblerflow/docker-imgs . If you want to add your image to this repository please fork it and make a Pull Request (PR) with the requested new image or create an issue asking to be added to the organization as a contributor.
Building docker images¶
Then, after the image has been added to the FlowCraft .. _docker-imgs https://github.com/assemblerflow/docker-imgs github repository, they can be built through .. _FlowCraft docker hub https://hub.docker.com/u/flowcraft/dashboard/ .
Tag naming¶
Each time a docker image is built using the automated build of docker hub it
should follow this nomenclature: version-patch
.
This is used to avoid the override of previous builds for the same images,
allowing for instance users to use different version of the same software using
the same docker image but with different tags.
Version
: Is a string with tree letters like this:1.1.1
. Versions should
change every time a new software is added the container.
Patch
: Is a number that follows a-
after the version. Patches should
change every time a change does not affect the software inside it. For example, updates to database related files required by some of the software inside the container.
Unofficial FlowCraft Docker images¶
Although we strongly recommend that all images are stored in FlowCraft .. _docker-imgs https://github.com/assemblerflow/docker-imgs github repo, it is not mandatory to do it. Images can be built in another github repo and also use another docker hub repository to build the images. However, do make sure that you define it correctly in the directives of the process as explained in Directives.
Dotfiles¶
Several dotfiles (files prefixed by a single .
, as in .status
) are
created at the beginning of every nextflow process that has the following
placeholder (see Create process template):
process myProcess {
{% include "post.txt" ignore missing %}
(...)
}
The actual script that creates the dotfiles is found in
flowcraft/bin
, is called set_dotfiles.sh
and executes the
following command:
touch .status .warning .fail .report.json .versions
Status¶
The .status
file simply stores a string with the run status of the process.
The supported status are:
pass
: The process finished successfullyfail
: The process ran without unexpected issues but failed due to some quality control checkerror
: The process exited with an unexpected error.
Warning¶
The .warning
file stores any warnings that may occur during the execution
of the process. There is no particular format for the warning messages other
than that each individual warning should be in a separate line.
Fail¶
The .fail
file stores any fail messages that may occur during the
execution of the process. When this occurs, the .status
channel must have
the fail
string as well. As in the warning dotfile, there is no
particular format for the fail message.
Report JSON¶
Important
The general specification of the report JSON changed in version 1.2.2. See the issue tracker for details.
The .report.json
file stores any information from a given process that is
deemed worthy of being reported and displayed at the end of the pipeline.
Any information can be stored in this file, as long as it is in JSON format,
but there are a couple of recommendations that are necessary to follow
for them to be processed by a reporting web app (Currently hosted at
flowcraft-webapp). However, if
data processing will be performed with custom scripts, feel free to specify
your own format.
Information for tables¶
Information meant to be displayed in tables should be in the following format:
json_dic = {
"tableRow": [{
"sample": "A",
"data": [{
"header": "Raw BP",
"value": 123,
"table": "qc"
}, {
"header": "Coverage",
"value": 32,
"table": "qc"
}]
}, {
"sample": "B",
"data": [{
"header": "Coverage",
"value": 35,
"table": "qc"
}]
}]
}
This provides table information for multiple samples in the same process. In this case, data for two samples is provided. For each sample, values for one or more headers can be provided. For instance, this report provides information about the Raw BP and Coverage for sample A and this information should go to the qc table. If any other information is relevant to build the table, feel free to add more elements to the JSON.
Information for plots¶
Information meant to be displayed in plots should be in the following format:
json_dic = {
"plotData": [{
"sample": "strainA",
"data": {
"sparkline": 23123,
"otherplot": [1,2,3]
}
}],
}
As in the table JSON, plotData should be an array with an entry for each sample. The data for each sample should be another JSON where the keys are the plot signatures, so that we know to which plot the data belongs. The corresponding values are whatever data object you need.
Other information¶
Other than tables and plots, which have a somewhat predefined format, there is not particular format for other information. They will simply store the data of interest to report and it will be the job of a downstream report app to process that data into an actual visual report.
Versions¶
The .version
dotfile should contain a list of JSON objects with the
version information of the programs used in any given process. There are
only two required key:value pairs:
program
: String with the name of the software/script/templateversion
: String with the version of said software.
As an example:
version = {
"program": "abricate"
"version": "0.3.7"
}
Key:value pairs with other metadata can be included at will for downstream processing.
Pipeline reporting¶
This section describes how the reports of a FlowCraft pipeline are generated and collected at the end of a run. These reports can then be sent to the FlowCraft web application where the results are visualized.
Important
Note that if the nextflow process reports add new types of data, one or more React components need to be added to the web application for them to be rendered.
Data collection¶
The data for the pipeline reports is collected from three dotfiles in each nextflow process (they should be present in each work sub directory):
- .report.json: Contains report data (See Report JSON for more information).
- .versions: Contains information about the versions of the software used (See Versions for more information).
- .command.trace: Contains resource usage information.
The .command.trace file is generated by nextflow when the trace scope is active. The .report.json and .version files are specific to FlowCraft pipelines.
Generation of dotfiles¶
Both report.json and .versions empty dotfiles are automatically generated
by the {% include "post.txt" ignore missing %}
placeholder, specified in the
Create process template section. Using this placeholder in your processes is all
that is needed.
Collection of dotfiles¶
The .report.json, .versions and .command.trace files are automatically
collected and sent to dedicated report channels in the pipeline by the
{%- include "compiler_channels.txt" ignore missing -%}
placeholder, specified
in the process creation section. Placing this placeholder in your
processes will generate the following line in the output channel specification:
set {{ sample_id|default("sample_id") }}, val("{{ task_name }}_{{ pid }}"), val("{{ pid }}"), file(".report.json"), file(".versions"), file(".command.trace") into REPORT_{{task_name}}_{{ pid }}
This line collects several metadata associated with the process along with the three dotfiles.
Compilation of dotfiles¶
As mentioned in the previous section, the dotfiles and other relevant metadata for are sent through special report channels to a FlowCraft component that is responsible for compiling all the information and generate a single report file at the end of each pipeline run.
This component is specified in flowcraft.generator.templates.report_compiler.nf
and it consists of two nextflow processes:
First, the report process receives the data from each executed process that sends report data and runs the
flowcraft/bin/prepare_reports.py
script on that data. This script will simply merge metadata and dotfiles information in a single JSON file. This file contains the following keys:reportJson
: The data in .report.json file.versions
: The data in .versions file.trace
: The data in .command.trace file.processId
: The process IDpipelineId
: The pipeline ID that defaults to one, unless specified in the parameters.projectid
: The project ID that defaults to one, unless specified in the parameters.userId
: The user ID that defaults to one, unless specified in the parameters.username
: The user name that defaults to user, unless specified in the parametersprocessName
: The name of the flowcraft component.workdir
: The work directory where the process was executed.
Second, all JSON files created in the process above are merged and a single reports JSON file is created. This file will contains the following structure:
reportJSON = { "data": { "results": [<array of report JSONs>] } }
Reports¶
Report JSON specification¶
The report JSON is quite flexibly on the information it can contain. Here are some guidelines to promote consistency on the reports generated by each component. In general, the reports file is an array of JSON objects that contain relevant information for each executed process in the pipeline:
reportFile = [{<processA/tagA reports>}, {<processB/tagB reports>}, ... ]
Nextflow metadata¶
The nextflow metada is automatically added to the reportFile as a single JSON entry
with the nfMetadata
key that contains the following information:
"nfMetadata": {
"scriptId": "${workflow.scriptId}",
"scriptName": "${workflow.scriptId}",
"profile": "${workflow.profile}",
"container": "${workflow.container}",
"containerEngine": "${workflow.containerEngine}",
"commandLine": "${workflow.commandLine}",
"runName": "${workflow.runName}",
"sessionId": "${workflow.sessionId}",
"projectDir": "${workflow.projectDir}",
"launchDir": "${workflow.launchDir}",
"start_time": "${workflow.start}"
}
Note
Unlike the remaining JSON entries in the report file, which are generated for
each process execution, the nfMetadata
entry is generated only once per
project execution.
Root¶
The reports contained in the reports.json
file for each process execution
are added to the root object:
{
"pipelineId": 1,
"processId": pid,
"processName": task_name,
"projectid": RUN_NAME,
"reportJson": reports,
"runName": RUN_NAME,
"scriptId": SCRIPT_ID,
"versions": versions,
"trace": trace,
"userId": 1,
"username": "user",
"workdir": dirname(abspath(report_json))
}
The other key:values are added automatically when the reports are compiled for each process execution.
Versions¶
Inside the root, the signature key for software version information is versions
:
"versions": [{
"program": "progA",
"version": "1.0.0",
"build": "1"
}, {
"program": "progB",
"version": "2.1"
}]
Only the program
and version
keys are mandatory.
ReportJson¶
Table data¶
Inside reportJson
, the signature key for table data is tableRow
:
"reportJson": {
"tableRow": [{
"sample": "strainA",
"data": [{
"header": "Raw BP",
"value": 123,
"table": "qc",
}, {
"header": "Coverage",
"value": 32,
"table": "qc"
}],
"sample": "strainB",
"data": [{
"header": "Raw BP",
"value": 321,
"table": "qc",
}, {
"header": "Coverage",
"value": 22,
"table": "qc"
}]
}]
}
tableRow
should contain an array of JSON for each sample with two key:value pairs:
sample
: Sample namedata
: Table data (see below).
data
should be an array of JSON with at least three key:value pairs:
header
: Column headervalue
: The data valuetable
: Informs to which table this data should go.
Note
Available table
keys: typing
, qc
, assembly
, abricate
,
chewbbaca
.
Plot data¶
Inside reportJson
, the signature key for plot data is plotData
:
"reportJson": {
"plotData": [{
"sample": "strainA",
"data": {
"sparkline": 23123,
"otherplot": [1,2,3]
}
}],
}
plotData
should contain an array of JSON for each sample with two key:value pairs:
sample
: Sample namedata
: Plot data (see below).
data
should contain a JSON object with the plot signatures as keys, and the relevant
plot data as value. This data can be any object (integer, float, array, JSON, etc).
It will be up to the components in the flowcraft web application to parse this data
and generate the appropriate chart.
Warnings and fails¶
Inside reportJson
, the signature key for warnings is warnings
and for
failures is fail
:
"reportJson": {
"warnings": [{
"sample": "strainA",
"table": "qc",
"value": ["message 1", "message 2"]
}],
"fail": [{
"sample": "strainA",
"table": "assembly",
"value": ["message 1"]
}]
}
warnings
/fail
should contain an array of JSON for each sample with
two key:value pairs:
sample
: Sample namevalue
: An array with one or more string messages.table
[optional]: If a table signature is provided, the warning/fail messages information will appear on that table. Otherwise, it will appear as a general warning/error that is associated to the sample but not to any particular table.
flowcraft package¶
Subpackages¶
flowcraft.generator package¶
Subpackages¶
flowcraft.generator.components package¶
-
class
flowcraft.generator.components.annotation.
Abricate
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Abricate mapping process template interface
This process is set with:
input_type
: assemblyoutput_type
: Noneptype
: post_assembly
It contains one secondary channel link end:
MAIN_assembly
(alias:MAIN_assembly
): Receives the last
assembly.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.annotation.
CardRgi
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
card’s rgi process template interface
This process is set with:
input_type
: fastaoutput_type
: txtptype
: resistance gene detection (assembly)
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.annotation.
Prokka
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Prokka mapping process template interface
This process is set with:
input_type
: assemblyoutput_type
: Noneptype
: post_assembly
It contains one secondary channel link end:
MAIN_assembly
(alias:MAIN_assembly
): Receives the last
assembly.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.annotation.
Diamond
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
diamond process for protein database queries
This process is set with:
input_type
: fastaoutput_type
: Noneptype
: post_assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly.
Bcalm
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Bcalm process template interface
This process is set with:
input_type
: fastqoutput_type
: assemblyptype
: assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly.
Spades
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Spades process template interface
This process is set with:
input_type
: fastqoutput_type
: assemblyptype
: assembly
It contains one secondary channel link end:
SIDE_max_len
(alias:SIDE_max_len
): Receives max read length
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly.
Skesa
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Skesa process template interface
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly.
ViralAssembly
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Process to assemble viral genomes, based on SPAdes and megahit
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly.
Abyss
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
ABySS process template interface
This process is set with:
input_type
: fastqoutput_type
: assemblyptype
: assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly.
Unicycler
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Unicycler process template interface
This process is set with:
input_type
: fastqoutput_type
: assemblyptype
: assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly_processing.
ProcessSkesa
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly_processing.
ProcessSpades
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Process spades process template interface
This process is set with:
input_type
: assemblyoutput_type
: assemblyptype
: post_assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly_processing.
AssemblyMapping
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Assembly mapping process template interface
This process is set with:
input_type
: assemblyoutput_type
: assemblyptype
: post_assembly
It contains one secondary channel link end:
MAIN_fq
(alias:_MAIN_assembly
): Receives the FastQ files
from the last process with
fastq
output type.It contains two status channels:
STATUS_am
: Status for the assembly_mapping processSTATUS_amp
: Status for the process_assembly_mapping process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly_processing.
Pilon
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Pilon mapping process template interface
This process is set with:
input_type
: assemblyoutput_type
: assemblyptype
: post_assembly
It contains one dependency process:
assembly_mapping
: Requires the BAM file generated by the
assembly mapping process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly_processing.
Bandage
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Visualize the assembly using Bandage
This process is set with:
input_type
: assemblyoutput_type
: noneptype
: post_assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.assembly_processing.
Quast
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Assess assembly quality using QUAST
This process is set with:
input_type
: assemblyoutput_type
: tsvptype
: post_assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.distance_estimation.
MashDist
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.distance_estimation.
MashScreen
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.distance_estimation.
MashSketchFasta
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.distance_estimation.
MashSketchFastq
(**kwargs)[source]¶ Bases:
flowcraft.generator.components.distance_estimation.MashSketchFasta
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.distance_estimation.
FastAni
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.downloads.
ReadsDownload
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Process template interface for reads downloading from SRA and NCBI
This process is set with:
input_type
: accessionsoutput_type
fastq
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.downloads.
FasterqDump
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Process template for fasterq-dump
This process is set with:
input_type
: accessionsoutput_type
fastq
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Concoct
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
CONCOCT process template interface for the taxonomic independent binning of metagenomic assemblies.
- This process is set with:
input_type
: assemblyoutput_type
: assemblyptype
: post_assembly
It contains one secondary channel link end:
MAIN_fq
(alias:_MAIN_assembly
): Receives the FastQ files
from the last process with
fastq
output type.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Kraken
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
kraken process template interface
This process is set with:
input_type
: fastqoutput_type
: txtptype
: taxonomic classification
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Kraken2
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
kraken2 process template interface
This process is set with:
input_type
: fastqoutput_type
: txtptype
: taxonomic classification
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Maxbin2
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
MaxBin2, a metagenomics binning software
This process is set with:
input_type
: assemblyoutput_type
: assemblyptype
: post_assembly
It contains one secondary channel link end:
MAIN_fq
(alias:_MAIN_assembly
): Receives the FastQ files
from the last process with
fastq
output type.Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Megahit
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
megahit process template interface
This process is set with:
input_type
: fastqoutput_type
: assemblyptype
: assembly
It contains one secondary channel link end:
SIDE_max_len
(alias:SIDE_max_len
): Receives max read length
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Metabat2
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
MetaBat2 process template interface for the taxonomic independent binning of metagenomic assemblies.
- This process is set with:
input_type
: assemblyoutput_type
: assemblyptype
: post_assembly
It contains one dependency process:
assembly_mapping
: Requires the BAM file generated by the
assembly mapping process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Metaspades
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Metaspades process template interface
This process is set with:
input_type
: fastqoutput_type
: assemblyptype
: assembly
It contains one secondary channel link end:
SIDE_max_len
(alias:SIDE_max_len
): Receives max read length
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Midas_species
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Midas species process template interface
This process is set with:
input_type
: fastqoutput_type
: txtptype
: taxonomic classification (species)
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
RemoveHost
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
bowtie2 to remove host reads process template interface
This process is set with:
input_type
: fastqoutput_type
: fastqptype
: removal os host reads
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Metaprob
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
MetaProb to bin metagenomic reads interface
This process is set with:
input_type
: fastqoutput_type
: csvptype
: binning of reads
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
SplitAssembly
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Component to filter metagenomic assemblies by contig size If the contig is larger than $param.size, it gets separated from the original assembly to continue the processes downstream of the pipeline.
This process is set with:
input_type
: fastaoutput_type
: fastaptype
: assembly filter
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.metagenomics.
Vamb
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Vamb process template interface for the taxonomic independent binning of metagenomic assemblies.
- This process is set with:
input_type
: assemblyoutput_type
: assemblyptype
: post_assembly
It contains one dependency process:
assembly_mapping
: Requires the BAM file generated by the
assembly mapping process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.mlst.
Mlst
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Mlst mapping process template interface
This process is set with:
input_type
: assemblyoutput_type
: Noneptype
: post_assembly
It contains one secondary channel link end:
MAIN_assembly
(alias:MAIN_assembly
): Receives the last
assembly.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.mlst.
Chewbbaca
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Chewbbaca process template interface
This process is set with:
input_type
: assemblyoutput_type
: Noneptype
: post_assembly
It contains one secondary channel link end:
MAIN_assembly
(alias:MAIN_assembly
): Receives the last
assembly.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.mlst.
Metamlst
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
MetaMlst mapping process template interface
This process is set with:
input_type
: readsoutput_type
: Noneptype
: pre_assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.patlas_mapping.
MappingPatlas
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.reads_quality_control.
IntegrityCoverage
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Process template interface for first integrity_coverage process
This process is set with:
input_type
: fastqoutput_type
: fastqptype
: pre_assembly
It contains two secondary channel link starts:
SIDE_phred
: Phred score of the FastQ filesSIDE_max_len
: Maximum read length
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.reads_quality_control.
CheckCoverage
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Process template interface for additional integrity_coverage process
This process is set with:
input_type
: fastqoutput_type
: fastqptype
: pre_assembly
It contains one secondary channel link start:
SIDE_max_len
: Maximum read length
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.reads_quality_control.
TrueCoverage
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
TrueCoverage process template interface
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.reads_quality_control.
Fastqc
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
FastQC process template interface
This process is set with:
input_type
: fastqoutput_type
: fastqptype
: pre_assembly
It contains two status channels:
STATUS_fastqc
: Status for the fastqc processSTATUS_report
: Status for the fastqc_report process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input -
status_channels
= None¶ list: Setting status channels for FastQC execution and FastQC report
-
class
flowcraft.generator.components.reads_quality_control.
Trimmomatic
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Trimmomatic process template interface
This process is set with:
input_type
: fastqoutput_type
: fastqptype
: pre_assembly
It contains one secondary channel link end:
SIDE_phred
(alias:SIDE_phred
): Receives FastQ phred score
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.reads_quality_control.
FastqcTrimmomatic
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Fastqc + Trimmomatic process template interface
This process executes FastQC only to inform the trim range for trimmomatic, not for QC checks.
This process is set with:
input_type
: fastqoutput_type
: fastqptype
: pre_assembly
It contains one secondary channel link end:
SIDE_phred
(alias:SIDE_phred
): Receives FastQ phred score
It contains three status channels:
STATUS_fastqc
: Status for the fastqc processSTATUS_report
: Status for the fastqc_report processSTATUS_trim
: Status for the trimmomatic process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.reads_quality_control.
FilterPoly
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
PrinSeq process to filter non-informative sequences from reads
This process is set with:
input_type
: fastqoutput_type
: fastqptype
: pre_assembly
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.reads_quality_control.
DownsampleFastq
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Downsamples FastQ file based on depth using seqtk
This process is set with:
input_type
: fastqoutput_type
: fastq
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.typing.
SeqTyping
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.typing.
PathoTyping
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.typing.
Sistr
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.typing.
Momps
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.typing.
DengueTyping
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.typing.
Seroba
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Serotyping of Streptococcus pneumoniae sequencing data
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.components.typing.
Pneumocat
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Serotyping of Streptococcus pneumoniae sequencing data
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
Submodules¶
flowcraft.generator.engine module¶
-
class
flowcraft.generator.engine.
NextflowGenerator
(process_connections, nextflow_file, process_map, pipeline_name='flowcraft', ignore_dependencies=False, auto_dependency=True, merge_params=True, export_params=False)[source]¶ Bases:
object
Methods
build
(self)Main pipeline builder dag_info_to_file
(self, dict_viz, …)Writes dag or fork information to output file export_directives
(self)Export pipeline directives as a JSON to stdout export_params
(self)Export pipeline params as a JSON to stdout fetch_docker_tags
(self)Export all dockerhub tags associated with each component given by the -t flag. render_pipeline
(self)Write pipeline attributes to json write_configs
(self, project_root)Wrapper method that writes all configuration files to the pipeline directory -
process_map
= None¶ dict: Maps the nextflow template name to the corresponding Process class of the component.
-
processes
= None¶ list: Stores the process interfaces in the specified order
-
lanes
= None¶ int: Stores the number of lanes in the pipelines
-
export_parameters
= None¶ bool: Determines whether the build mode is only for the export of parameters in JSON format. Setting to True will disabled some checks, such as component dependency requirements
-
nf_file
= None¶ str: Path to file where the pipeline will be generated
-
pipeline_name
= None¶ str: Name of the pipeline, for customization and help purposes.
-
template
= None¶ str: String that will harbour the pipeline code
-
secondary_channels
= None¶ dict: Stores secondary channel links
-
main_raw_inputs
= None¶ list: Stores the main raw inputs from the user parameters into the first process(es).
-
merge_params
= None¶ bool: Determines whether the params of the pipeline should be merged (i.e., the same param name in multiple components is merged into one) or if they should be unique and specific to each component.
-
extra_inputs
= None¶
-
status_channels
= None¶ list: Stores the status channels from each process
-
skip_class
= None¶ list: Stores the Process classes that should be skipped when iterating over the
processes
list.
-
resources
= None¶ str: Stores the resource directives string for each nextflow process. See
NextflowGenerator._get_resources_string()
.
-
containers
= None¶ str: Stores the container directives string for each nextflow process. See
NextflowGenerator._get_container_string()
.
-
params
= None¶ str: Stores the params directives string for the nextflow pipeline. See
NextflowGenerator._get_params_string()
-
config
= None¶ str: Stores de configuration for the nextflow pipeline. See
NextflowGenerator._get_config_string()
-
user_config
= None¶ str: Stores the user configuration file placeholder. This is an empty configuration file that is only added the first time to a project directory. If the file already exists, it will not overwrite it.
-
compilers
= None¶ dict: Maps the information about each available compiler process in flowcraft. The key of each entry is the name/signature of the compiler process. The value is a json/dict object that contains two key:pair values:
cls
: The reference to the compiler class object.template
: The nextflow template file of the process.
-
dag_info_to_file
(self, dict_viz, output_folder, output_file)[source]¶ Writes dag or fork information to output file
Parameters: - dict_viz: dict
Tree like dictionary that is used to export tree data of processes to html file and here for the treeDag.json, stored in the resources directory
- output_folder: str
Path folder to save the output file
- output_file: str
Output file name
-
render_pipeline
(self)[source]¶ Write pipeline attributes to json
This function writes the pipeline and their attributes to a json file, that is intended to be read by resources/pipeline_graph.html to render a graphical output showing the DAG.
-
write_configs
(self, project_root)[source]¶ Wrapper method that writes all configuration files to the pipeline directory
-
export_params
(self)[source]¶ Export pipeline params as a JSON to stdout
This run mode iterates over the pipeline processes and exports the params dictionary of each component as a JSON to stdout.
Export all dockerhub tags associated with each component given by the -t flag.
-
build
(self)[source]¶ Main pipeline builder
This method is responsible for building the
NextflowGenerator.template
attribute that will contain the nextflow code of the pipeline.First it builds the header, then sets the main channels, the secondary inputs, secondary channels and finally the status channels. When the pipeline is built, is writes the code to a nextflow file.
-
flowcraft.generator.error_handling module¶
flowcraft.generator.header_skeleton module¶
flowcraft.generator.inspect module¶
flowcraft.generator.pipeline_parser module¶
-
flowcraft.generator.pipeline_parser.
guess_process
(query_str, process_map)[source]¶ Function to guess processes based on strings that are not available in process_map. If the string has typos and is somewhat similar (50%) to any process available in flowcraft it will print info to the terminal, suggesting the most similar processes available in flowcraft.
Parameters: - query_str: str
The string of the process with potential typos
- process_map:
The dictionary that contains all the available processes
-
flowcraft.generator.pipeline_parser.
remove_inner_forks
(text)[source]¶ Recursively removes nested brackets
This function is used to remove nested brackets from fork strings using regular expressions
Parameters: - text: str
The string that contains brackets with inner forks to be removed
Returns: - text: str
the string with only the processes that are not in inner forks, thus the processes that belong to a given fork.
-
flowcraft.generator.pipeline_parser.
empty_tasks
(p_string)[source]¶ Function to check if pipeline string is empty or has an empty string
Parameters: - p_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
brackets_but_no_lanes
(p_string)[source]¶ Function to check if a LANE_TOKEN is provided but no fork is initiated. Parameters ———- p_string: str
- String with the definition of the pipeline, e.g.::
- ‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
brackets_insanity_check
(p_string)[source]¶ This function performs a check for different number of ‘(‘ and ‘)’ characters, which indicates that some forks are poorly constructed.
Parameters: - p_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
lane_char_insanity_check
(p_string)[source]¶ This function performs a sanity check for multiple ‘|’ character between two processes.
Parameters: - p_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
final_char_insanity_check
(p_string)[source]¶ This function checks if lane token is the last element of the pipeline string.
Parameters: - p_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
fork_procs_insanity_check
(p_string)[source]¶ This function checks if the pipeline string contains a process between the fork start token or end token and the separator (lane) token. Checks for the absence of processes in one of the branches of the fork [‘|)' and '(|’] and for the existence of a process before starting a fork (in an inner fork) [‘|(‘].
Parameters: - p_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
start_proc_insanity_check
(p_string)[source]¶ This function checks if there is a starting process after the beginning of each fork. It checks for duplicated start tokens [‘((‘].
Parameters: - p_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
late_proc_insanity_check
(p_string)[source]¶ This function checks if there are processes after the close token. It searches for everything that isn’t “|” or “)” after a “)” token.
Parameters: - p_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
inner_fork_insanity_checks
(pipeline_string)[source]¶ This function performs two sanity checks in the pipeline string. The first check, assures that each fork contains a lane token ‘|’, while the second check looks for duplicated processes within the same fork.
Parameters: - pipeline_string: str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
-
flowcraft.generator.pipeline_parser.
insanity_checks
(pipeline_str)[source]¶ Wrapper that performs all sanity checks on the pipeline string
Parameters: - pipeline_str : str
String with the pipeline definition
-
flowcraft.generator.pipeline_parser.
parse_pipeline
(pipeline_str)[source]¶ - Parses a pipeline string into a list of dictionaries with the connections
- between processes
Parameters: - pipeline_str : str
- String with the definition of the pipeline, e.g.::
‘processA processB processC(ProcessD | ProcessE)’
Returns: - pipeline_links : list
-
flowcraft.generator.pipeline_parser.
get_source_lane
(fork_process, pipeline_list)[source]¶ Returns the lane of the last process that matches fork_process
Parameters: - fork_process : list
List of processes before the fork.
- pipeline_list : list
List with the pipeline connection dictionaries.
Returns: - int
Lane of the last process that matches fork_process
-
flowcraft.generator.pipeline_parser.
get_lanes
(lanes_str)[source]¶ From a raw pipeline string, get a list of lanes from the start of the current fork.
When the pipeline is being parsed, it will be split at every fork position. The string at the right of the fork position will be provided to this function. It’s job is to retrieve the lanes that result from that fork, ignoring any nested forks.
Parameters: - lanes_str : str
Pipeline string after a fork split
Returns: - lanes : list
List of lists, with the list of processes for each lane
-
flowcraft.generator.pipeline_parser.
linear_connection
(plist, lane)[source]¶ Connects a linear list of processes into a list of dictionaries
Parameters: - plist : list
List with process names. This list should contain at least two entries.
- lane : int
Corresponding lane of the processes
Returns: - res : list
List of dictionaries with the links between processes
-
flowcraft.generator.pipeline_parser.
fork_connection
(source, sink, source_lane, lane)[source]¶ Makes the connection between a process and the first processes in the lanes to which it forks.
The
lane
argument should correspond to the lane of the source process. For each lane insink
, the lane counter will increase.Parameters: - source : str
Name of the process that is forking
- sink : list
List of the processes where the source will fork to. Each element corresponds to the start of a lane.
- source_lane : int
Lane of the forking process
- lane : int
Lane of the source process
Returns: - res : list
List of dictionaries with the links between processes
-
flowcraft.generator.pipeline_parser.
linear_lane_connection
(lane_list, lane)[source]¶ Parameters: - lane_list : list
Each element should correspond to a list of processes for a given lane
- lane : int
Lane counter before the fork start
Returns: - res : list
List of dictionaries with the links between processes
-
flowcraft.generator.pipeline_parser.
add_unique_identifiers
(pipeline_str)[source]¶ - Returns the pipeline string with unique identifiers and a dictionary with
- references between the unique keys and the original values
Parameters: - pipeline_str : str
Pipeline string
Returns: - str
Pipeline string with unique identifiers
- dict
Match between process unique values and original names
-
flowcraft.generator.pipeline_parser.
remove_unique_identifiers
(identifiers_to_tags, pipeline_links)[source]¶ Removes unique identifiers and add the original process names to the already parsed pipelines
Parameters: - identifiers_to_tags : dict
Match between unique process identifiers and process names
- pipeline_links: list
Parsed pipeline list with unique identifiers
Returns: - list
Pipeline list with original identifiers
flowcraft.generator.process module¶
-
class
flowcraft.generator.process.
Process
(template)[source]¶ Bases:
object
Main interface for basic process functionality
The
Process
class is intended to be inherited by specific process classes (e.g.,IntegrityCoverage
) and provides the basic functionality to build the channels and links between processes.Child classes are expected to inherit the
__init__
execution, which basically means that at least, the child must be defined as:class ChildProcess(Process): def__init__(self, **kwargs): super().__init__(**kwargs)
This ensures that when the
ChildProcess
class is instantiated, it automatically sets the attributes of the parent class.This also means that child processes must be instantiated providing information on the process type and jinja2 template with the nextflow code.
Parameters: - template : str
Name of the jinja2 template with the nextflow code for that process. Templates are stored in
generator/templates
.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input -
RAW_MAPPING
= {'accessions': {'channel': 'IN_accessions_raw', 'channel_str': 'Channel.fromPath(params.{0}).ifEmpty {{ exit 1, "No accessions file provided with path:\'${{params.{0}}}\'" }}', 'checks': 'if (!params.{0}){{ exit 1, "\'{0}\' parameter missing" }}\n', 'default_value': 'null', 'description': 'Path file with accessions, one perline. (default: $params.fastq)', 'params': 'accessions'}, 'fasta': {'channel': 'IN_fasta_raw', 'channel_str': 'Channel.fromPath(params.{0}).map{{ it -> file(it).exists() ? [it.toString().tokenize(\'/\').last().tokenize(\'.\')[0..-2].join(\'.\'), it] : null }}.ifEmpty {{ exit 1, "No fasta files provided with pattern:\'${{params.{0}}}\'" }}', 'checks': 'if (params.{0} instanceof Boolean){{exit 1, "\'{0}\' must be a path pattern. Provide value:\'$params.{0}\'"}}\nif (!params.{0}){{ exit 1, "\'{0}\' parameter missing"}}', 'default_value': "'fasta/*.fasta'", 'description': 'Path fasta files. (default: $params.fastq)', 'params': 'fasta'}, 'fastq': {'channel': 'IN_fastq_raw', 'channel_str': 'Channel.fromFilePairs(params.{0}).ifEmpty {{ exit 1, "No fastq files provided with pattern:\'${{params.{0}}}\'" }}', 'checks': 'if (params.{0} instanceof Boolean){{exit 1, "\'{0}\' must be a path pattern. Provide value:\'$params.{0}\'"}}\nif (!params.{0}){{ exit 1, "\'{0}\' parameter missing"}}', 'default_value': "'fastq/*_{1,2}.*'", 'description': 'Path expression to paired-end fastq files. (default: $params.fastq)', 'params': 'fastq'}}¶ dict: Contains the mapping between the
Process.input_type
attribute and the corresponding nextflow parameter and main channel definition, e.g.:"fastq" : { "params": "fastq", "channel: "<channel> }
-
pid
= None¶ int: Process ID number that represents the order and position in the generated pipeline
-
template
= None¶ str: Template name for the current process. This string will be used to fetch the file containing the corresponding jinja2 template in the
_set_template()
method
-
input_type
= None¶ str: Type of expected input data. Used to verify the connection between two processes is viable.
-
output_type
= None¶ str: Type of output data. Used to verify the connection between two processes is viable.
-
ignore_type
= None¶ boolean: If True, this process will ignore the input/output type requirements. This attribute is set to True for terminal singleton forks in the pipeline.
-
ignore_pid
= None¶ boolean: If True, this process will not make the pid advance. This is used for terminal forks before the end of the pipeline.
-
dependencies
= None¶ list: Contains the dependencies of the current process in the form of the
Process.template
attribute (e.g., [fastqc
])
-
input_channel
= None¶ str: Place holder of the main input channel for the current process. This attribute can change dynamically depending on the forks and secondary channels in the final pipeline.
-
output_channel
= None¶ str: Place holder of the main output channel for the current process. This attribute can change dynamically depending on the forks and secondary channels in the final pipeline.
-
input_user_channel
= None¶ dict: Stores a dictionary of two key:value pairs containing the raw input channel for the process. This is automatically
determined by theinput_type
attribute, and will- fetch the information that is mapped in the
RAW_MAPPING
- variable. It will only be used by the first process(es) defined in a pipeline.
- fetch the information that is mapped in the
-
link_start
= None¶ list: List of strings with the starting points for secondary channels. When building the pipeline, these strings will be matched with equal strings in the
link_end
attribute of other Processes.
-
link_end
= None¶ list: List of dictionaries containing the a string of the ending point for a secondary channel. Each dictionary should contain at least two key/vals:
{"link": <link string>, "alias":<string for template>}
-
status_channels
= None¶ list: Name of the status channels produced by the process. By default, it sets a single status channel. If more than one status channels are required for the process, list each one in this attribute (e.g.,
FastQC.status_channels
)
-
status_strs
= None¶ str: Name of the status channel for the current process. These strings will be provided to the StatusCompiler process to collect and compile status reports
-
forks
= None¶ list: List of strings with the literal definition of the forks for the current process, ready to be added to the template string.
-
main_forks
= None¶ list: List of the channels onto which the main output should be forked into. They will be automatically added to the
main_forks
attribute when setting the secondary channels
-
secondary_inputs
= None¶ list: List of dictionaries with secondary input channels from nextflow parameters. This dictionary should contain two key:value pairs with the
params
key, containing the parameter name, and thechannel
key, containing the nextflow channel definition:{ "params": "pathoSpecies", "channel": "IN_pathoSpecies = Channel .value(params.pathoSpecies)" }
-
extra_input
= None¶ str: with the name of the params that will be used to provide extra input into the process. This extra input will be mixed with the main input channel using nextflow’s
mix
operator. Its channel will be defined at the start of the pipeline, based on thechannel_str
key of theRAW_MAPPING
for the corresponding input type.
-
params
= None¶ dict: Maps the parameter names to the corresponding default values.
-
param_id
= None¶ str: The parameter id suffix that will be added to each parameter. In case it is empty, the multiple identical parameters in different components will be merged.
-
directives
= None¶ dict: Specifies the directives (cpus, memory, container) for each nextflow process in the template. If specified, this directives will be added to the nextflow configuration file. Otherwise, the default values for cpus and memory will be used. In the case of containers, they will not run inside any container.
- The current supported directives are:
- cpus
- memory
- container
- container tag/version
An example of directives for two process is as follows:
self.directives = { "processA": {"cpus": 1, "memory": "1GB"}, "processB": {"memory": "5GB", "container": "my/image", "version": "0.5.0"} }
-
compiler
= None¶ dict: Specifies channels from the current process that are received by a compiler process. Each key in this dictionary should match a compiler process key in
compilers
. The value should be a list of the channels that will be fed to the compiler process:self.compiler["patlas_consensus"] = ["mashScreenOutputChannel"]
-
set_main_channel_names
(self, input_suffix, output_suffix, lane)[source]¶ Sets the main channel names based on the provide input and output channel suffixes. This is performed when connecting processes.
Parameters: - input_suffix : str
Suffix added to the input channel. Should be based on the lane and an arbitrary unique id
- output_suffix : str
Suffix added to the output channel. Should be based on the lane and an arbitrary unique id
- lane : int
Sets the lane of the process.
-
set_param_id
(self, param_id)[source]¶ Sets the param_id for the process, which will be used to render the template.
Parameters: - param_id : str
The
param_id
attribute of the process.
-
get_user_channel
(self, input_channel, input_type=None)[source]¶ Returns the main raw channel for the process
Provided with at least a channel name, this method returns the raw channel name and specification (the nextflow string definition) for the process. By default, it will fork from the raw input of the process’
input_type
attribute. However, this behaviour can be overridden by providing theinput_type
argument.If the specified or inferred input type exists in the
RAW_MAPPING
dictionary, the channel info dictionary will be retrieved along with the specified input channel. Otherwise, it will return None.An example of the returned dictionary is:
{"input_channel": "myChannel", "params": "fastq", "channel": "IN_fastq_raw", "channel_str":"IN_fastq_raw = Channel.fromFilePairs(params.fastq)" }
Returns: - dict or None
Dictionary with the complete raw channel info. None if no channel is found.
-
static
render
(template, context)[source]¶ Wrapper to the jinja2 render method from a template file
Parameters: - template : str
Path to template file.
- context : dict
Dictionary with kwargs context to populate the template
-
template_str
¶ Class property that returns a populated template string
This property allows the template of a particular process to be dynamically generated and returned when doing
Process.template_str
.Returns: - x : str
String with the complete and populated process template
-
set_channels
(self, **kwargs)[source]¶ General purpose method that sets the main channels
This method will take a variable number of keyword arguments to set the
Process._context
attribute with the information on the main channels for the process. This is done by appending the process ID (Process.pid
) attribute to the input, output and status channel prefix strings. In the output channel, the process ID is incremented by 1 to allow the connection with the channel in the next process.The
**kwargs
system for setting theProcess._context
attribute also provides additional flexibility. In this way, individual processes can provide additional information not covered in this method, without changing it.Parameters: - kwargs : dict
Dictionary with the keyword arguments for setting up the template context
-
update_main_forks
(self, sink)[source]¶ Updates the forks attribute with the sink channel destination
Parameters: - sink : str
Channel onto which the main input will be forked to
-
set_secondary_channel
(self, source, channel_list)[source]¶ General purpose method for setting a secondary channel
This method allows a given source channel to be forked into one or more channels and sets those forks in the
Process.forks
attribute. Both the source and the channels in thechannel_list
argument must be the final channel strings, which means that this method should be called only after setting the main channels.If the source is not a main channel, this will simply create a fork or set for every channel in the
channel_list
argument list:SOURCE_CHANNEL_1.into{SINK_1;SINK_2}
If the source is a main channel, this will apply some changes to the output channel of the process, to avoid overlapping main output channels. For instance, forking the main output channel for process 2 would create a
MAIN_2.into{...}
. The issue here is that theMAIN_2
channel is expected as the input of the next process, but now is being used to create the fork. To solve this issue, the output channel is modified into_MAIN_2
, and the fork is set to the channels provided channels plus theMAIN_2
channel:_MAIN_2.into{MAIN_2;MAIN_5;...}
Parameters: - source : str
String with the name of the source channel
- channel_list : list
List of channels that will receive a fork of the secondary channel
-
update_attributes
(self, attr_dict)[source]¶ Updates the directives attribute from a dictionary object.
This will only update the directives for processes that have been defined in the subclass.
Parameters: - attr_dict : dict
Dictionary containing the attributes that will be used to update the process attributes and/or directives.
-
class
flowcraft.generator.process.
Compiler
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Extends the Process methods to status-type processes
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_compiler_channels
(self, channel_list[, …])General method for setting the input channels for the status process set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input -
set_compiler_channels
(self, channel_list, operator='mix')[source]¶ General method for setting the input channels for the status process
Given a list of status channels that are gathered during the pipeline construction, this method will automatically set the input channel for the status process. This makes use of the
mix
channel operator of nextflow for multiple channels:STATUS_1.mix(STATUS_2,STATUS_3,...)
This will set the
status_channels
key for the_context
attribute of the process.Parameters: - channel_list : list
List of strings with the final name of the status channels
- operator : str
Specifies the operator used to join the compiler channels. Available options are ‘mix’and ‘join’.
-
class
flowcraft.generator.process.
Init
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Process
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_extra_inputs
(self, channel_dict)Sets the initial definition of the extra input channels. set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_raw_inputs
(self, raw_input)Sets the main input channels of the pipeline and their forks. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel set_secondary_inputs
(self, channel_dict)Adds secondary inputs to the start of the pipeline. update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input -
set_raw_inputs
(self, raw_input)[source]¶ Sets the main input channels of the pipeline and their forks.
The
raw_input
dictionary input should contain one entry for each input type (fastq, fasta, etc). The corresponding value should be a dictionary/json with the following key:values:channel
: Name of the raw input channel (e.g.: channel1)channel_str
: The nextflow definition of the channel and- eventual checks (e.g.: channel1 = Channel.fromPath(param))
raw_forks
: A list of channels to which the channel name will for to.
Each new type of input parameter is automatically added to the
params
attribute, so that they are automatically collected for the pipeline description and help.Parameters: - raw_input : dict
Contains an entry for each input type with the channel name, channel string and forks.
-
set_secondary_inputs
(self, channel_dict)[source]¶ Adds secondary inputs to the start of the pipeline.
This channels are inserted into the pipeline file as they are provided in the values of the argument.
Parameters: - channel_dict : dict
Each entry should be <parameter>: <channel string>.
-
set_extra_inputs
(self, channel_dict)[source]¶ Sets the initial definition of the extra input channels.
The
channel_dict
argument should contain the input type and destination channel of each parameter (which is the key):channel_dict = { "param1": { "input_type": "fasta" "channels": ["abricate_2_3", "chewbbaca_3_4"] } }
Parameters: - channel_dict : dict
Dictionary with the extra_input parameter as key, and a dictionary as a value with the input_type and destination channels
-
class
flowcraft.generator.process.
StatusCompiler
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Compiler
Status compiler process template interface
This special process receives the status channels from all processes in the generated pipeline.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_compiler_channels
(self, channel_list[, …])General method for setting the input channels for the status process set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.process.
ReportCompiler
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Compiler
Reports compiler process template interface
This special process receives the report channels from all processes in the generated pipeline.
Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_compiler_channels
(self, channel_list[, …])General method for setting the input channels for the status process set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
-
class
flowcraft.generator.process.
PatlasConsensus
(**kwargs)[source]¶ Bases:
flowcraft.generator.process.Compiler
Patlas consensus compiler process template interface
This special process receives the channels associated with the
patlas_consensus
key.Attributes: template_str
Class property that returns a populated template string
Methods
get_user_channel
(self, input_channel[, …])Returns the main raw channel for the process render
(template, context)Wrapper to the jinja2 render method from a template file set_channels
(self, \*\*kwargs)General purpose method that sets the main channels set_compiler_channels
(self, channel_list[, …])General method for setting the input channels for the status process set_main_channel_names
(self, input_suffix, …)Sets the main channel names based on the provide input and output channel suffixes. set_param_id
(self, param_id)Sets the param_id for the process, which will be used to render the template. set_secondary_channel
(self, source, channel_list)General purpose method for setting a secondary channel update_attributes
(self, attr_dict)Updates the directives attribute from a dictionary object. update_main_forks
(self, sink)Updates the forks attribute with the sink channel destination update_main_input
flowcraft.generator.process_details module¶
-
flowcraft.generator.process_details.
colored_print
(msg, color_label='white_bold')[source]¶ - This function enables users to add a color to the print. It also enables to pass end_char to print allowing to print several strings in the same line in different prints.
Parameters: - color_string: str
The color code to pass to the function, which enables color change as well as background color change.
- msg: str
The actual text to be printed
- end_char: str
The character in which each print should finish. By default it will be “
- “.
-
flowcraft.generator.process_details.
procs_dict_parser
(procs_dict)[source]¶ This function handles the dictionary of attributes of each Process class to print to stdout lists of all the components or the components which the user specifies in the -t flag.
Parameters: - procs_dict: dict
A dictionary with the class attributes for all the components (or components that are used by the -t flag), that allow to create both the short_list and detailed_list. Dictionary example: {“abyss”: {‘input_type’: ‘fastq’, ‘output_type’: ‘fasta’, ‘dependencies’: [], ‘directives’: {‘abyss’: {‘cpus’: 4, ‘memory’: ‘{ 5.GB * task.attempt }’, ‘container’: ‘flowcraft/abyss’, ‘version’: ‘2.1.1’, ‘scratch’: ‘true’}}}
-
flowcraft.generator.process_details.
proc_collector
(process_map, args, pipeline_string)[source]¶ Function that collects all processes available and stores a dictionary of the required arguments of each process class to be passed to procs_dict_parser
Parameters: - process_map: dict
The dictionary with the Processes currently available in flowcraft and their corresponding classes as values
- args: argparse.Namespace
The arguments passed through argparser that will be access to check the type of list to be printed
- pipeline_string: str
the pipeline string
flowcraft.generator.recipe module¶
-
class
flowcraft.generator.recipe.
InnuendoRecipe
[source]¶ Bases:
object
Methods
build_downstream
(self, process_descriptions, …)Builds the downstream pipeline of the current process build_pipeline_string
(self, forks)Parses, filters and merge all possible pipeline forks into the final pipeline string build_upstream
(self, process_descriptions, …)Builds the upstream pipeline of the current process define_pipeline_string
(self, …)Builds the possible forks and connections between the provided processes run_auto_pipeline
(self, tasks)Main method to run the automatic pipeline creation validate_pipeline
(pipeline_string)Validate pipeline string -
count_forks
= None¶ int : counts the total possible number of forks
-
forks
= None¶ list : a list with all the possible forks
-
pipeline_string
= None¶ str : the generated pipeline string
-
process_to_id
= None¶ dict: key value between the process name and its identifier
-
static
validate_pipeline
(pipeline_string)[source]¶ Validate pipeline string
Validates the pipeline string by searching for forbidden characters
Parameters: - pipeline_string : str
STring with the processes provided
-
build_upstream
(self, process_descriptions, task, all_tasks, task_pipeline, count_forks, total_tasks, forks)[source]¶ Builds the upstream pipeline of the current process
Checks for the upstream processes to the current process and adds them to the current pipeline fragment if they were provided in the process list.
Parameters: - process_descriptions : dict
Information of processes input, output and if is forkable
- task : str
Current process
- all_tasks : list
A list of all provided processes
- task_pipeline : list
Current pipeline fragment
- count_forks : int
Current number of forks
- total_tasks : str
All space separated processes
- forks : list
Current forks
- Returns
- ——-
- list : resulting pipeline fragment
-
build_downstream
(self, process_descriptions, task, all_tasks, task_pipeline, count_forks, total_tasks, forks)[source]¶ Builds the downstream pipeline of the current process
Checks for the downstream processes to the current process and adds them to the current pipeline fragment.
Parameters: - process_descriptions : dict
Information of processes input, output and if is forkable
- task : str
Current process
- all_tasks : list
A list of all provided processes
- task_pipeline : list
Current pipeline fragment
- count_forks : int
Current number of forks
- total_tasks : str
All space separated processes
- forks : list
Current forks
- Returns
- ——-
- list : resulting pipeline fragment
-
define_pipeline_string
(self, process_descriptions, tasks, check_upstream, check_downstream, count_forks, total_tasks, forks)[source]¶ Builds the possible forks and connections between the provided processes
This method loops through all the provided tasks and builds the upstream and downstream pipeline if required. It then returns all possible forks than need to be merged à posteriori`
Parameters: - process_descriptions : dict
Information of processes input, output and if is forkable
- tasks : str
Space separated processes
- check_upstream : bool
If is to build the upstream pipeline of the current task
- check_downstream : bool
If is to build the downstream pipeline of the current task
- count_forks : int
Number of current forks
- total_tasks : str
All space separated processes
- forks : list
Current forks
Returns: - list : List with all the possible pipeline forks
-
build_pipeline_string
(self, forks)[source]¶ Parses, filters and merge all possible pipeline forks into the final pipeline string
This method checks for shared start and end sections between forks and merges them according to the shared processes:
[[spades, ...], [skesa, ...], [...,[spades, skesa]]] -> [..., [[spades, ...], [skesa, ...]]]
Then it defines the pipeline string by replacing the arrays levels to the flowcraft fork format:
[..., [[spades, ...], [skesa, ...]]] -> ( ... ( spades ... | skesa ... ) )
Parameters: - forks : list
List with all the possible pipeline forks.
Returns: - str : String with the pipeline definition used as input for
- parse_pipeline
-
run_auto_pipeline
(self, tasks)[source]¶ Main method to run the automatic pipeline creation
This method aggregates the functions required to build the pipeline string that can be used as input for the workflow generator.
Parameters: - tasks : str
A string with the space separated tasks to be included in the pipeline
Returns: - str : String with the pipeline definition used as input for
- parse_pipeline
-
-
class
flowcraft.generator.recipe.
Innuendo
(*args, **kwargs)[source]¶ Bases:
flowcraft.generator.recipe.InnuendoRecipe
Recipe class for the INNUENDO Project. It has all the available in the platform for quick use of the processes in the scope of the project.
Methods
build_downstream
(self, process_descriptions, …)Builds the downstream pipeline of the current process build_pipeline_string
(self, forks)Parses, filters and merge all possible pipeline forks into the final pipeline string build_upstream
(self, process_descriptions, …)Builds the upstream pipeline of the current process define_pipeline_string
(self, …)Builds the possible forks and connections between the provided processes run_auto_pipeline
(self, tasks)Main method to run the automatic pipeline creation validate_pipeline
(pipeline_string)Validate pipeline string
-
flowcraft.generator.recipe.
brew_innuendo
(args)[source]¶ Brews a given list of processes according to the recipe
Parameters: - args : argparse.Namespace
The arguments passed through argparser that will be used to check the the recipe, tasks and brew the process
Returns: - str
The final pipeline string, ready for the engine.
- list
List of process strings.
-
class
flowcraft.generator.recipe.
Recipe
[source]¶ Bases:
object
Methods
brew -
pipeline_str
= None¶ str: The raw pipeline string, with no attribute or directives, except for number indicators for when there are duplicate components.
e.g.: “fastqc trimmomatic spades” e.g.: “fastqc trimmomatic (spades#1 | spades#2)
-
directives
= None¶ dict: Dictionary with the parameters and directives for each component in the pipeline_str attribute. Missing components will be left with the default parameters and directives.
-
-
flowcraft.generator.recipe.
brew_recipe
(recipe_name)[source]¶ Returns a pipeline string from a recipe name.
Parameters: - recipe_name : str
Name of the recipe. Must match the name attribute in one of the classes defined in
flowcraft.generator.recipes
Returns: - str
Pipeline string ready for parsing and processing by flowcraft engine
Module contents¶
Placeholder for Process creation docs
flowcraft.templates package¶
Subpackages¶
flowcraft.templates.flowcraft_utils package¶
-
flowcraft.templates.flowcraft_utils.flowcraft_base.
log_error
()[source]¶ Nextflow specific function that logs an error upon unexpected failing
-
class
flowcraft.templates.flowcraft_utils.flowcraft_base.
MainWrapper
(f)[source]¶ Bases:
object
Methods
__call__
(self, \*args, \*\*kwargs)Call self as a function. build_versions
(self)Writes versions JSON for a template file -
build_versions
(self)[source]¶ Writes versions JSON for a template file
This method creates the JSON file
.versions
based on the metadata and specific functions that are present in a given template script.It starts by fetching the template metadata, which can be specified via the
__version__
,__template__
and__build__
attributes. If all of these attributes exist, it starts to populate a JSON/dict array (Note that the absence of any one of them will prevent the version from being written).Then, it will search the template scope for functions that start with the substring
__set_version
(For example ``def __set_version_fastqc()`). These functions should gather the version of an arbitrary program and return a JSON/dict object with the following information:{ "program": <program_name>, "version": <version> "build": <build> }
This JSON/dict object is then written in the
.versions
file.
-
Submodules¶
flowcraft.templates.assembly_report module¶
This module is intended to provide a summary report for a given assembly in Fasta format.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string.- e.g.:
'SampleA'
- e.g.:
assembly
: Path to assembly file in Fasta format.- e.g.:
'assembly.fasta'
- e.g.:
${sample_id}_assembly_report.csv
: CSV with summary information of the assembly.- e.g.:
'SampleA_assembly_report.csv'
- e.g.:
-
class
flowcraft.templates.assembly_report.
Assembly
(assembly_file, sample_id)[source]¶ Bases:
object
Class that parses and filters an assembly file in Fasta format.
This class parses an assembly file, collects a number of summary statistics and metadata from the contigs and reports.
Parameters: - assembly_file : str
Path to assembly file.
- sample_id : str
Name of the sample for the current assembly.
Methods
get_coverage_sliding
(self, coverage_file[, …])Parameters: get_gc_sliding
(self[, window])Calculates a sliding window of the GC content for the assembly get_summary_stats
(self[, output_csv])Generates a CSV report with summary statistics about the assembly -
summary_info
= None¶ OrderedDict: Initialize summary information dictionary. Contains keys:
ncontigs
: Number of contigsavg_contig_size
: Average size of contigsn50
: N50 metrictotal_len
: Total assembly lengthavg_gc
: Average GC proportionmissing_data
: Count of missing data characters
-
contigs
= None¶ OrderedDict: Object that maps the contig headers to the corresponding sequence
-
contig_coverage
= None¶ OrderedDict: Object that maps the contig headers to the corresponding list of per-base coverage
-
sample
= None¶ str: Sample id
-
contig_boundaries
= None¶ dict: Maps the boundaries of each contig in the genome
-
get_summary_stats
(self, output_csv=None)[source]¶ Generates a CSV report with summary statistics about the assembly
The calculated statistics are:
- Number of contigs
- Average contig size
- N50
- Total assembly length
- Average GC content
- Amount of missing data
Parameters: - output_csv: str
Name of the output CSV file.
flowcraft.templates.fastqc module¶
This module is intended to run FastQC on paired-end FastQ files.
The following variables are expected whether using NextFlow or the
main()
executor.
fastq_pair
: Pair of FastQ file paths- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
The generated output are output files that contain an object, usually a string.
pair_{1,2}_data
: File containing FastQC report at the nucleotide level for each pair- e.g.:
'pair_1_data'
and'pair_2_data'
- e.g.:
pair_{1,2}_summary
: File containing FastQC report for each category and for each pair- e.g.:
'pair_1_summary'
and'pair_2_summary'
- e.g.:
-
flowcraft.templates.fastqc.
convert_adatpers
(adapter_fasta)[source]¶ Generates an adapter file for FastQC from a fasta file.
The provided adapters file is assumed to be a simple fasta file with the adapter’s name as header and the corresponding sequence:
>TruSeq_Universal_Adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT >TruSeq_Adapter_Index 1 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
Parameters: - adapter_fasta : str
Path to Fasta file with adapter sequences.
Returns: - adapter_out : str or None
The path to the reformatted adapter file. Returns
None
if the adapters file does not exist or the path is incorrect.
flowcraft.templates.fastqc_report module¶
This module is intended parse the results of FastQC for paired end FastQ samples. It parses two reports:
- Categorical report
- Nucleotide level report.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample identification string- e.g.:
'SampleA'
- e.g.:
result_p1
: Path to both FastQC result files for pair 1- e.g.:
'SampleA_1_data SampleA_1_summary'
- e.g.:
result_p2
: Path to both FastQC result files for pair 2- e.g.:
'SampleA_2_data SampleA_2_summary'
- e.g.:
opts
: Specify additional arguments for executing fastqc_report. The arguments should be a string of command line arguments, The accepted arguments are:'--ignore-tests'
: Ignores test results from FastQC categorical summary. This is used in the first run of FastQC.
The generated output are output files that contain an object, usually a string.
fastqc_health
: Stores the health check for the current sample. If it- passes all checks, it contains only the string ‘pass’. Otherwise, contains
the summary categories and their respective results
- e.g.:
'pass'
optimal_trim
: Stores a tuple with the optimal trimming positions for 5’- and 3’ ends of the reads.
- e.g.:
'15 151'
-
flowcraft.templates.fastqc_report.
write_json_report
(sample_id, data1, data2)[source]¶ Writes the report
Parameters: - data1
- data2
-
flowcraft.templates.fastqc_report.
get_trim_index
(biased_list)[source]¶ Returns the trim index from a
bool
listProvided with a list of
bool
elements ([False, False, True, True]
), this function will assess the index of the list that minimizes the number of True elements (biased positions) at the extremities. To do so, it will iterate over the boolean list and find an index position where there are two consecutiveFalse
elements after aTrue
element. This will be considered as an optimal trim position. For example, in the following list:[True, True, False, True, True, False, False, False, False, ...]
The optimal trim index will be the 4th position, since it is the first occurrence of a
True
element with two False elements after it.If the provided
bool
list has noTrue
elements, then the 0 index is returned.Parameters: - biased_list: list
List of
bool
elements, whereTrue
means a biased site.
Returns: - x : index position of the biased list for the optimal trim.
-
flowcraft.templates.fastqc_report.
trim_range
(data_file)[source]¶ Assess the optimal trim range for a given FastQC data file.
This function will parse a single FastQC data file, namely the ‘Per base sequence content’ category. It will retrieve the A/T and G/C content for each nucleotide position in the reads, and check whether the G/C and A/T proportions are between 80% and 120%. If they are, that nucleotide position is marked as biased for future removal.
Parameters: - data_file: str
Path to FastQC data file.
Returns: - trim_nt: list
List containing the range with the best trimming positions for the corresponding FastQ file. The first element is the 5’ end trim index and the second element is the 3’ end trim index.
-
flowcraft.templates.fastqc_report.
get_sample_trim
(p1_data, p2_data)[source]¶ Get the optimal read trim range from data files of paired FastQ reads.
Given the FastQC data report files for paired-end FastQ reads, this function will assess the optimal trim range for the 3’ and 5’ ends of the paired-end reads. This assessment will be based on the ‘Per sequence GC content’.
Parameters: - p1_data: str
Path to FastQC data report file from pair 1
- p2_data: str
Path to FastQC data report file from pair 2
Returns: - optimal_5trim: int
Optimal trim index for the 5’ end of the reads
- optima_3trim: int
Optimal trim index for the 3’ end of the reads
See also
-
flowcraft.templates.fastqc_report.
get_summary
(summary_file)[source]¶ Parses a FastQC summary report file and returns it as a dictionary.
This function parses a typical FastQC summary report file, retrieving only the information on the first two columns. For instance, a line could be:
'PASS Basic Statistics SH10762A_1.fastq.gz'
This parser will build a dictionary with the string in the second column as a key and the QC result as the value. In this case, the returned
dict
would be something like:{"Basic Statistics": "PASS"}
Parameters: - summary_file: str
Path to FastQC summary report.
Returns: - summary_info:
OrderedDict
Returns the information of the FastQC summary report as an ordered dictionary, with the categories as strings and the QC result as values.
-
flowcraft.templates.fastqc_report.
check_summary_health
(summary_file, **kwargs)[source]¶ Checks the health of a sample from the FastQC summary file.
Parses the FastQC summary file and tests whether the sample is good or not. There are four categories that cannot fail, and two that must pass in order for the sample pass this check. If the sample fails the quality checks, a list with the failing categories is also returned.
Categories that cannot fail:
fail_sensitive = [ "Per base sequence quality", "Overrepresented sequences", "Sequence Length Distribution", "Per sequence GC content" ]
Categories that must pass:
must_pass = [ "Per base N content", "Adapter Content" ]
Parameters: - summary_file: str
Path to FastQC summary file.
Returns: - x : bool
Returns
True
if the sample passes all tests.False
if not.- summary_info : list
A list with the FastQC categories that failed the tests. Is empty if the sample passes all tests.
flowcraft.templates.integrity_coverage module¶
This module receives paired FastQ files, a genome size estimate and a minimum coverage threshold and has three purposes while iterating over the FastQ files:
- Checks the integrity of FastQ files (corrupted files).
- Guesses the encoding of FastQ files (this can be turned off in the
opts
argument).- Estimates the coverage for each sample.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string- e.g.:
'SampleA'
- e.g.:
fastq_pair
: Pair of FastQ file paths- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
gsize
: Expected genome size- e.g.:
'2.5'
- e.g.:
cov
: Minimum coverage threshold- e.g.:
'15'
- e.g.:
opts
: Specify additional arguments for executing integrity_coverage. The arguments should be a string of command line arguments, such as ‘-e’. The accepted arguments are:'-e'
: Skip encoding guess.
The generated output are output files that contain an object, usually a string.
(Values within ${}
are substituted by the corresponding variable.)
${sample_id}_encoding
: Stores the encoding for the sample FastQ. If no encoding could be guessed, write ‘None’ to file.- e.g.:
'Illumina-1.8'
or'None'
- e.g.:
${sample_id}_phred
: Stores the phred value for the sample FastQ. If no phred could be guessed, write ‘None’ to file.'33'
or'None'
${sample_id}_coverage
: Stores the expected coverage of the samples, based on a given genome size.'112'
or'fail'
${sample_id}_report
: Stores the report on the expected coverage estimation. This string written in this file will appear in the coverage report.'${sample_id}, 112, PASS'
${sample_id}_max_len
: Stores the maximum read length for the current sample.'152'
In case of a corrupted sample, all expected output files should have
'corrupt'
written.
-
flowcraft.templates.integrity_coverage.
RANGES
= {'Illumina-1.3': [64, (64, 104)], 'Illumina-1.5': [64, (66, 105)], 'Illumina-1.8': [33, (33, 74)], 'Sanger': [33, (33, 73)], 'Solexa': [64, (59, 104)]}¶ dict: Dictionary containing the encoding values for several fastq formats. The key contains the format and the value contains a list with the corresponding phred score and a list with the range of encodings.
-
flowcraft.templates.integrity_coverage.
MAGIC_DICT
= {b'\\x1f\\x8b\\x08': 'gz', b'\\x42\\x5a\\x68': 'bz2', b'\\x50\\x4b\\x03\\x04': 'zip'}¶ dict: Dictionary containing the binary signatures for three compression formats (gzip, bzip2 and zip).
-
flowcraft.templates.integrity_coverage.
guess_file_compression
(file_path, magic_dict=None)[source]¶ Guesses the compression of an input file.
This function guesses the compression of a given file by checking for a binary signature at the beginning of the file. These signatures are stored in the
MAGIC_DICT
dictionary. The supported compression formats are gzip, bzip2 and zip. If none of the signatures in this dictionary are found at the beginning of the file, it returnsNone
.Parameters: - file_path : str
Path to input file.
- magic_dict : dict, optional
Dictionary containing the signatures of the compression types. The key should be the binary signature and the value should be the compression format. If left
None
, it falls back toMAGIC_DICT
.
Returns: - file_type : str or None
If a compression type is detected, returns a string with the format. If not, returns
None
.
-
flowcraft.templates.integrity_coverage.
get_qual_range
(qual_str)[source]¶ Get range of the Unicode encode range for a given string of characters.
The encoding is determined from the result of the
ord()
built-in.Parameters: - qual_str : str
Arbitrary string.
Returns: - x : tuple
(Minimum Unicode code, Maximum Unicode code).
-
flowcraft.templates.integrity_coverage.
get_encodings_in_range
(rmin, rmax)[source]¶ Returns the valid encodings for a given encoding range.
The encoding ranges are stored in the
RANGES
dictionary, with the encoding name as a string and a list as a value containing the phred score and a tuple with the encoding range. For a given encoding range provided via the two first arguments, this function will return all possible encodings and phred scores.Parameters: - rmin : int
Minimum Unicode code in range.
- rmax : int
Maximum Unicode code in range.
Returns: - valid_encodings : list
List of all possible encodings for the provided range.
- valid_phred : list
List of all possible phred scores.
flowcraft.templates.mapping2json module¶
flowcraft.templates.mashdist2json module¶
This module is intended to generate a json output for mash dist results that can be imported in pATLAS.
The following variables are expected whether using NextFlow or the
main()
executor.
mash_output
: String with the name of the mash screen output file.- e.g.:
'fastaFileA_mashdist.txt'
- e.g.:
-
flowcraft.templates.mashdist2json.
send_to_output
(master_dict, mash_output, sample_id, assembly_file)[source]¶ Send dictionary to output json file This function sends master_dict dictionary to a json file if master_dict is populated with entries, otherwise it won’t create the file
Parameters: - master_dict: dict
dictionary that stores all entries for a specific query sequence in multi-fasta given to mash dist as input against patlas database
- last_seq: str
string that stores the last sequence that was parsed before writing to file and therefore after the change of query sequence between different rows on the input file
- mash_output: str
the name/path of input file to main function, i.e., the name/path of the mash dist output txt file.
- sample_id: str
The name of the sample being parse to .report.json file
flowcraft.templates.mashscreen2json module¶
This module is intended to generate a json output for mash screen results that can be imported in pATLAS.
The following variables are expected whether using NextFlow or the
main()
executor.
mash_output
: String with the name of the mash screen output file.- e.g.:
'sortedMashScreenResults_SampleA.txt'
- e.g.:
flowcraft.templates.megahit module¶
This module is intended execute megahit on paired-end FastQ files.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string.- e.g.:
'SampleA'
- e.g.:
fastq_pair
: Pair of FastQ file paths.- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
kmers
: Setting for megahit kmers. Can be either'auto'
,'default'
or a user provided list. All must be odd, in the range 15-255, increment <= 28- e.g.:
'auto'
or'default'
or'55 77 99 113 127'
- e.g.:
clear
: If ‘true’, remove the input fastq files at the end of thecomponent run, IF THE FILES ARE IN THE WORK DIRECTORY
contigs.fa
: Main output of megahit with the assembly- e.g.:
contigs.fa
- e.g.:
megahit_status
: Stores the status of the megahit run. If it was successfully executed, it stores'pass'
. Otherwise, it stores theSTDERR
message.- e.g.:
'pass'
- e.g.:
-
flowcraft.templates.megahit.
set_kmers
(kmer_opt, max_read_len)[source]¶ Returns a kmer list based on the provided kmer option and max read len.
Parameters: - kmer_opt : str
The k-mer option. Can be either
'auto'
,'default'
or a sequence of space separated integers,'23, 45, 67'
.- max_read_len : int
The maximum read length of the current sample.
Returns: - kmers : list
List of k-mer values that will be provided to megahit.
flowcraft.templates.metaspades module¶
This module is intended execute metaSpades on paired-end FastQ files.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string.- e.g.:
'SampleA'
- e.g.:
fastq_pair
: Pair of FastQ file paths.- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
kmers
: Setting for Spades kmers. Can be either'auto'
,'default'
or a user provided list.- e.g.:
'auto'
or'default'
or'55 77 99 113 127'
- e.g.:
contigs.fasta
: Main output of spades with the assembly- e.g.:
contigs.fasta
- e.g.:
spades_status
: Stores the status of the spades run. If it was successfully executed, it stores'pass'
. Otherwise, it stores theSTDERR
message.- e.g.:
'pass'
- e.g.:
-
flowcraft.templates.metaspades.
clean_up
(fastq)[source]¶ Cleans the temporary fastq files. If they are symlinks, the link source is removed
Parameters: - fastq : list
List of fastq files.
-
flowcraft.templates.metaspades.
set_kmers
(kmer_opt, max_read_len)[source]¶ Returns a kmer list based on the provided kmer option and max read len.
Parameters: - kmer_opt : str
The k-mer option. Can be either
'auto'
,'default'
or a sequence of space separated integers,'23, 45, 67'
.- max_read_len : int
The maximum read length of the current sample.
Returns: - kmers : list
List of k-mer values that will be provided to Spades.
flowcraft.templates.pATLAS_consensus_json module¶
This module is intended to generate a json output from the consensus results from all the approaches available through options (mapping, assembly, mash screen)
The following variables are expected whether using NextFlow or the
main()
executor.
mapping_json
: String with the name of the json file with mapping results.- e.g.:
'mapping_SampleA.json'
- e.g.:
dist_json
: String with the name of the json file with mash dist results.- e.g.:
'mash_dist_SampleA.json'
- e.g.:
screen_json
: String with the name of the json file with mash screen results.- e.g.:
'mash_screen_sampleA.json'
- e.g.:
flowcraft.templates.pipeline_status module¶
This module is intended to collect pipeline run statistics (such as time, cpu, RAM for each tasks) into a report JSON
trace_file
: Trace file generated by nextflow
flowcraft.templates.process_abricate module¶
This module is intended parse the results of the Abricate for one or more samples.
The following variables are expected whether using NextFlow or the
main()
executor.
abricate_files
: Path to abricate output file.- e.g.:
'abr_resfinder.tsv'
- e.g.:
None
-
class
flowcraft.templates.process_abricate.
Abricate
(fls)[source]¶ Bases:
object
Main parser for Abricate output files.
This class parses one or more output files from Abricate, usually from different databases. In addition to the parsing methods, it also provides a flexible method to filter and re-format the content of the abricate files.
Parameters: - fls : list
List of paths to Abricate output files.
Methods
get_filter
(self, \*args, \*\*kwargs)Wrapper of the iter_filter method that returns a list with results iter_filter
(self, filters[, databases, …])General purpose filter iterator. parse_files
(self, fls)Public method for parsing abricate output files. -
storage
= None¶ dic: Main storage of Abricate’s file content. Each entry corresponds to a single line and contains the keys:
- ``log_file``: Name of the summary log file containing abricate results - ``infile``: Input file of Abricate. - ``reference``: Reference of the query sequence. - ``seq_range``: Range of the query sequence in the database sequence. - ``gene``: AMR gene name. - ``accession``: The genomic source of the sequence. - ``database``: The database the sequence came from. - ``coverage``: Proportion of gene covered. - ``identity``: Proportion of exact nucleotide matches.
-
parse_files
(self, fls)[source]¶ Public method for parsing abricate output files.
This method is called at at class instantiation for the provided output files. Additional abricate output files can be added using this method after the class instantiation.
Parameters: - fls : list
List of paths to Abricate files
-
iter_filter
(self, filters, databases=None, fields=None, filter_behavior='and')[source]¶ General purpose filter iterator.
This general filter iterator allows the filtering of entries based on one or more custom filters. These filters must contain an entry of the storage attribute, a comparison operator, and the test value. For example, to filter out entries with coverage below 80:
my_filter = ["coverage", ">=", 80]
Filters should always be provide as a list of lists:
iter_filter([["coverage", ">=", 80]]) # or my_filters = [["coverage", ">=", 80], ["identity", ">=", 50]] iter_filter(my_filters)
As a convenience, a list of the desired databases can be directly specified using the database argument, which will only report entries for the specified databases:
iter_filter(my_filters, databases=["plasmidfinder"])
By default, this method will yield the complete entry record. However, the returned filters can be specified using the fields option:
iter_filter(my_filters, fields=["reference", "coverage"])
Parameters: - filters : list
List of lists with the custom filter. Each list should have three elements. (1) the key from the entry to be compared; (2) the comparison operator; (3) the test value. Example:
[["identity", ">", 80]]
.- databases : list
List of databases that should be reported.
- fields : list
List of fields from each individual entry that are yielded.
- filter_behavior : str
options:
'and'
'or'
Sets the behaviour of the filters, if multiple filters have been provided. By default it is set to'and'
, which means that an entry has to pass all filters. It can be set to'or'
, in which case one one of the filters has to pass.
Yields: - dic : dict
Dictionary object containing a
Abricate.storage
entry that passed the filters.
-
class
flowcraft.templates.process_abricate.
AbricateReport
(*args, **kwargs)[source]¶ Bases:
flowcraft.templates.process_abricate.Abricate
Report generator for single Abricate output files
This class is intended to parse an Abricate output file from a single sample and database and generates a JSON report for the report webpage.
Parameters: - fls : list
List of paths to Abricate output files.
- database : (optional) str
Name of the database for the current report. If not provided, it will be inferred based on the first entry of the Abricate file.
Methods
get_filter
(self, \*args, \*\*kwargs)Wrapper of the iter_filter method that returns a list with results get_plot_data
(self)Generates the JSON report to plot the gene boxes get_table_data
(self)iter_filter
(self, filters[, databases, …])General purpose filter iterator. parse_files
(self, fls)Public method for parsing abricate output files. write_report_data
(self)Writes the JSON report to a json file -
get_plot_data
(self)[source]¶ Generates the JSON report to plot the gene boxes
Following the convention of the reports platform, this method returns a list of JSON/dict objects with the information about each entry in the abricate file. The information contained in this JSON is:
{contig_id: <str>, seqRange: [<int>, <int>], gene: <str>, accession: <str>, coverage: <float>, identity: <float> }
Note that the seqRange entry contains the position in the corresponding contig, not the absolute position in the whole assembly.
Returns: - json_dic : list
List of JSON/dict objects with the report data.
flowcraft.templates.process_assembly module¶
This module is intended to process the output of assemblies from a single sample from programs such as Spades or Skesa. The main input is an assembly file produced by an assembler, which will then be filtered according to user-specified parameters.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string.- e.g.:
'SampleA'
- e.g.:
assembly
: Fasta file with the assembly.- e.g.:
'contigs.fasta'
- e.g.:
opts
: List of options for processing spades assembly.- Minimum contig length.
- e.g.:
'150'
- e.g.:
- Minimum k-mer coverage.
- e.g.:
'2'
- e.g.:
- Maximum number of contigs per 1.5Mb.
- e.g.:
'100'
- e.g.:
assembler
: The name of the assembler- e.g.:
spades
- e.g.:
(Values within ${}
are substituted by the corresponding variable.)
'${sample_id}.assembly.fasta'
: Fasta file with the filtered assembly.- e.g.:
'Sample1.assembly.fasta'
- e.g.:
${sample_id}.report.fasta
: CSV file with the results of the filters for each contig.- e.g.:
'Sample1.report.csv'
- e.g.:
-
class
flowcraft.templates.process_assembly.
Assembly
(assembly_file, min_contig_len, min_kmer_cov, sample_id)[source]¶ Bases:
object
Class that parses and filters a Fasta assembly file
This class parses an assembly fasta file, collects a number of summary statistics and metadata from the contigs, filters contigs based on user-defined metrics and writes filtered assemblies and reports.
Parameters: - assembly_file : str
Path to assembly file.
- min_contig_len : int
Minimum contig length when applying the initial assembly filter.
- min_kmer_cov : int
Minimum k-mer coverage when applying the initial assembly. filter.
- sample_id : str
Name of the sample for the current assembly.
Methods
filter_contigs
(self, \*comparisons)Filters the contigs of the assembly according to user provided comparisons. get_assembly_length
(self)Returns the length of the assembly, without the filtered contigs. write_assembly
(self, output_file[, filtered])Writes the assembly to a new file. write_report
(self, output_file)Writes a report with the test results for the current assembly -
contigs
= None¶ dict: Dictionary storing data for each contig.
-
filtered_ids
= None¶ list: List of filtered contig_ids.
-
min_gc
= None¶ float: Sets the minimum GC content on a contig.
-
sample
= None¶ str: The name of the sample for the assembly.
-
report
= None¶ dict: Will contain the filtering results for each contig.
-
filters
= None¶ list: Setting initial filters to check when parsing the assembly file. This can be later changed using the ‘filter_contigs’ method.
-
filter_contigs
(self, *comparisons)[source]¶ Filters the contigs of the assembly according to user provided comparisons.
The comparisons must be a list of three elements with the
contigs
key, operator and test value. For example, to filter contigs with a minimum length of 250, a comparison would be:self.filter_contigs(["length", ">=", 250])
The filtered contig ids will be stored in the
filtered_ids
list.The result of the test for all contigs will be stored in the
report
dictionary.Parameters: - comparisons : list
List with contig key, operator and value to test.
-
get_assembly_length
(self)[source]¶ Returns the length of the assembly, without the filtered contigs.
Returns: - x : int
Total length of the assembly.
flowcraft.templates.process_assembly_mapping module¶
This module is intended to process the coverage report from the
assembly_mapping
process.
TODO: Better purpose
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string.- e.g.:
'SampleA'
- e.g.:
assembly
: Fasta assembly file.- e.g.:
'SH10761A.assembly.fasta'
- e.g.:
coverage
: TSV file with the average coverage for each assembled contig.- e.g.:
'coverage.tsv'
- e.g.:
coverage_bp
: TSV file with the coverage for each assembled bp.- e.g.:
'coverage.tsv'
- e.g.:
bam_file
: BAM file with the alignment of reads to the genome.- e.g.:
'sorted.bam'
- e.g.:
opts
: List of options for processing assembly mapping output.- Minimum coverage for assembled contigs. Can be``auto``.
- e.g.:
'auto'
or'10'
- e.g.:
- Maximum number of contigs.
- e.g.: ‘100’
gsize
: Expected genome size.- e.g.:
'2.5'
- e.g.:
${sample_id}_filtered.assembly.fasta
: Filtered assembly file in Fasta format.- e.g.:
'SampleA_filtered.assembly.fasta'
- e.g.:
filtered.bam
: BAM file with the same filtering as the assembly file.- e.g.:
filtered.bam
- e.g.:
-
flowcraft.templates.process_assembly_mapping.
parse_coverage_table
(coverage_file)[source]¶ Parses a file with coverage information into objects.
This function parses a TSV file containing coverage results for all contigs in a given assembly and will build an
OrderedDict
with the information about their coverage and length. The length information is actually gathered from the contig header using a regular expression that assumes the usual header produced by Spades:contig_len = int(re.search("length_(.+?)_", line).group(1))
Parameters: - coverage_file : str
Path to TSV file containing the coverage results.
Returns: - coverage_dict : OrderedDict
Contains the coverage and length information for each contig.
- total_size : int
Total size of the assembly in base pairs.
- total_cov : int
Sum of coverage values across all contigs.
-
flowcraft.templates.process_assembly_mapping.
filter_assembly
(assembly_file, minimum_coverage, coverage_info, output_file)[source]¶ Generates a filtered assembly file.
This function generates a filtered assembly file based on an original assembly and a minimum coverage threshold.
Parameters: - assembly_file : str
Path to original assembly file.
- minimum_coverage : int or float
Minimum coverage required for a contig to pass the filter.
- coverage_info : OrderedDict or dict
Dictionary containing the coverage information for each contig.
- output_file : str
Path where the filtered assembly file will be generated.
-
flowcraft.templates.process_assembly_mapping.
filter_bam
(coverage_info, bam_file, min_coverage, output_bam)[source]¶ Uses Samtools to filter a BAM file according to minimum coverage
Provided with a minimum coverage value, this function will use Samtools to filter a BAM file. This is performed to apply the same filter to the BAM file as the one applied to the assembly file in
filter_assembly()
.Parameters: - coverage_info : OrderedDict or dict
Dictionary containing the coverage information for each contig.
- bam_file : str
Path to the BAM file.
- min_coverage : int
Minimum coverage required for a contig to pass the filter.
- output_bam : str
Path to the generated filtered BAM file.
-
flowcraft.templates.process_assembly_mapping.
check_filtered_assembly
(coverage_info, coverage_bp, minimum_coverage, genome_size, contig_size, max_contigs, sample_id)[source]¶ Checks whether a filtered assembly passes a size threshold
Given a minimum coverage threshold, this function evaluates whether an assembly will pass the minimum threshold of
genome_size * 1e6 * 0.8
, which means 80% of the expected genome size or the maximum threshold ofgenome_size * 1e6 * 1.5
, which means 150% of the expected genome size. It will issue a warning if any of these thresholds is crossed. In the case of an expected genome size below 80% it will return False.Parameters: - coverage_info : OrderedDict or dict
Dictionary containing the coverage information for each contig.
- coverage_bp : dict
Dictionary containing the per base coverage information for each contig. Used to determine the total number of base pairs in the final assembly.
- minimum_coverage : int
Minimum coverage required for a contig to pass the filter.
- genome_size : int
Expected genome size.
- contig_size : dict
Dictionary with the len of each contig. Contig headers as keys and the corresponding lenght as values.
- max_contigs : int
Maximum threshold for contig number. A warning is issued if this threshold is crossed.
- sample_id : str
Id or name of the current sample
Returns: - x : bool
True if the filtered assembly size is higher than 80% of the expected genome size.
-
flowcraft.templates.process_assembly_mapping.
get_coverage_from_file
(coverage_file)[source]¶ Parameters: - coverage_file
-
flowcraft.templates.process_assembly_mapping.
evaluate_min_coverage
(coverage_opt, assembly_coverage, assembly_size)[source]¶ Evaluates the minimum coverage threshold from the value provided in the coverage_opt.
Parameters: - coverage_opt : str or int or float
If set to “auto” it will try to automatically determine the coverage to 1/3 of the assembly size, to a minimum value of 10. If it set to a int or float, the specified value will be used.
- assembly_coverage : int or float
The average assembly coverage for a genome assembly. This value is retrieved by the :py:func:parse_coverage_table function.
- assembly_size : int
The size of the genome assembly. This value is retrieved by the py:func:get_assembly_size function.
Returns: - x: int
Minimum coverage threshold.
-
flowcraft.templates.process_assembly_mapping.
get_assembly_size
(assembly_file)[source]¶ Returns the number of nucleotides and the size per contig for the provided assembly file path
Parameters: - assembly_file : str
Path to assembly file.
Returns: - assembly_size : int
Size of the assembly in nucleotides
- contig_size : dict
Length of each contig (contig name as key and length as value)
flowcraft.templates.skesa module¶
This module is intended execute Skesa on paired-end FastQ files.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string.- e.g.:
'SampleA'
- e.g.:
fastq_pair
: Pair of FastQ file paths.- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
clear
: If ‘true’, remove the input fastq files at the end of the- component run, IF THE FILES ARE IN THE WORK DIRECTORY
${sample_id}_*.assembly.fasta
: Main output of skesawith the assembly- e.g.:
sample_1_skesa.fasta
- e.g.:
clear
: If ‘true’, remove the input fastq files at the end of the- component run, IF THE FILES ARE IN THE WORK DIRECTORY
flowcraft.templates.spades module¶
This module is intended execute Spades on paired-end FastQ files.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Sample Identification string.- e.g.:
'SampleA'
- e.g.:
fastq_pair
: Pair of FastQ file paths.- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
kmers
: Setting for Spades kmers. Can be either'auto'
,'default'
or a user provided list.- e.g.:
'auto'
or'default'
or'55 77 99 113 127'
- e.g.:
opts
: List of options for spades execution.- The minimum number of reads to consider an edge in the de Bruijn graph during the assembly.
- e.g.:
'5'
- e.g.:
- Minimum contigs k-mer coverage.
- e.g.:
['2' '2']
- e.g.:
clear
: If ‘true’, remove the input fastq files at the end of thecomponent run, IF THE FILES ARE IN THE WORK DIRECTORY
contigs.fasta
: Main output of spades with the assembly- e.g.:
contigs.fasta
- e.g.:
spades_status
: Stores the status of the spades run. If it was successfully executed, it stores'pass'
. Otherwise, it stores theSTDERR
message.- e.g.:
'pass'
- e.g.:
-
flowcraft.templates.spades.
set_kmers
(kmer_opt, max_read_len)[source]¶ Returns a kmer list based on the provided kmer option and max read len.
Parameters: - kmer_opt : str
The k-mer option. Can be either
'auto'
,'default'
or a sequence of space separated integers,'23, 45, 67'
.- max_read_len : int
The maximum read length of the current sample.
Returns: - kmers : list
List of k-mer values that will be provided to Spades.
flowcraft.templates.trimmomatic module¶
This module is intended execute trimmomatic on paired-end FastQ files.
The following variables are expected whether using NextFlow or the
main()
executor.
sample_id
: Pair of FastQ file paths.- e.g.:
'SampleA'
- e.g.:
fastq_pair
: Pair of FastQ file paths.- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
trim_range
: Crop range detected using FastQC.- e.g.:
'15 151'
- e.g.:
opts
: List of options for trimmomatic- e.g.:
'["5:20", "3", "3", "55"]'
- e.g.:
'[trim_sliding_window, trim_leading, trim_trailing, trim_min_length]'
- e.g.:
phred
: List of guessed phred values for each sample- e.g.:
'[SampleA: 33, SampleB: 33]'
- e.g.:
clear
: If ‘true’, remove the input fastq files at the end of the- component run, IF THE FILES ARE IN THE WORK DIRECTORY
The generated output are output files that contain an object, usually a string.
(Values within ${}
are substituted by the corresponding variable.)
${sample_id}_*P*
: Pair of paired FastQ files generated by Trimmomatic- e.g.:
'SampleA_1_P.fastq.gz SampleA_2_P.fastq.gz'
- e.g.:
trimmomatic_status
: Stores the status of the trimmomatic run. If it was successfully executed, it stores ‘pass’. Otherwise, it stores theSTDERR
message.- e.g.:
'pass'
- e.g.:
-
flowcraft.templates.trimmomatic.
parse_log
(log_file)[source]¶ Retrieves some statistics from a single Trimmomatic log file.
This function parses Trimmomatic’s log file and stores some trimming statistics in an
OrderedDict
object. This object contains the following keys:clean_len
: Total length after trimming.total_trim
: Total trimmed base pairs.total_trim_perc
: Total trimmed base pairs in percentage.5trim
: Total base pairs trimmed at 5’ end.3trim
: Total base pairs trimmed at 3’ end.
Parameters: - log_file : str
Path to trimmomatic log file.
Returns: - x :
OrderedDict
Object storing the trimming statistics.
-
flowcraft.templates.trimmomatic.
write_report
(storage_dic, output_file, sample_id)[source]¶ Writes a report from multiple samples.
Parameters: - storage_dic : dict or
OrderedDict
Storage containing the trimming statistics. See
parse_log()
for its generation.- output_file : str
Path where the output file will be generated.
- storage_dic : dict or
-
flowcraft.templates.trimmomatic.
clean_up
(fastq_pairs, clear)[source]¶ Cleans the working directory of unwanted temporary files
flowcraft.templates.trimmomatic_report module¶
This module is intended parse the results of the Trimmomatic log for a set of one or more samples.
The following variables are expected whether using NextFlow or the
main()
executor.
log_files
: Trimmomatic log files.- e.g.:
'Sample1_trimlog.txt Sample2_trimlog.txt'
- e.g.:
trimmomatic_report.csv
: Summary report of the trimmomatic logs for all samples
-
flowcraft.templates.trimmomatic_report.
parse_log
(log_file)[source]¶ Retrieves some statistics from a single Trimmomatic log file.
This function parses Trimmomatic’s log file and stores some trimming statistics in an
OrderedDict
object. This object contains the following keys:clean_len
: Total length after trimming.total_trim
: Total trimmed base pairs.total_trim_perc
: Total trimmed base pairs in percentage.5trim
: Total base pairs trimmed at 5’ end.3trim
: Total base pairs trimmed at 3’ end.
Parameters: - log_file : str
Path to trimmomatic log file.
Returns: - x :
OrderedDict
Object storing the trimming statistics.
-
flowcraft.templates.trimmomatic_report.
write_report
(storage_dic, output_file, sample_id)[source]¶ Writes a report from multiple samples.
Parameters: - storage_dic : dict or
OrderedDict
Storage containing the trimming statistics. See
parse_log()
for its generation.- output_file : str
Path where the output file will be generated.
- sample_id : str
Id or name of the current sample.
- storage_dic : dict or
Module contents¶
Placeholder for template generation docs