Ion Torrent SDK

Release v5.10.

This document reviews all the points of interest for programmatically interfacing with Torrent Suite™ Software.

Torrent Suite™ Software Plugin System

This section describes the plugin framework and explains how to create plugins using all the available features. To understand this section, we recommend that you have at a minimum a working knowledge of python, object-oriented programming and HTML/javascript.

Getting Started with Plugins

The plugin framework is primarily an extension of the analysis pipeline and executes custom python modules (plugins) at different points in the pipeline process. There are three reasons for writing a plugin:

  1. Data Management: The transfer or backup of data to a secondary file server or remote site.
  2. Quality Assurance/Quality Control: These plugins check the quality of the data and give you access to some of the larger and transient data used in signal processing, which are eventually deleted.
  3. Application Analysis: This is broadest and most useful category which bridges the gap between general pipeline workflow and application-specific analysis and reporting.

There is nothing strict about these categories. They have no technical bearing on the functioning of the plugins other than a conceptual framework for deciding whether to use a plugin or not.

Quick Start

Enter the following python code into a file called MyPlugin.py inside a new directory called MyPlugin.

import subprocess
from ion.plugin import *


class MyPlugin(IonPlugin):
    version = "1.0.0.0"

    def launch(self, data=None):
        output = subprocess.check_output(['ls', '-l'])
        with open("status_block.html", "w") as html_fp:
            html_fp.write("<html><body><pre>")
            html_fp.write(output)
            html_fp.write("</pre></body></html>")


if __name__ == "__main__":
    PluginCLI()

Compress the MyPlugin directory (ZIP file format). See Packaging & Installation for help. Click Install or Upgrade Plugin to upload the archive on the Torrent Suite™ Software plugins page. Navigate to an existing Torrent Suite™ Software run report, click Select Plugins to Run, then select MyPlugin. The plugin code executes and the output displays in an iframe on the report.

Pipeline Overview

Plugins are fundamentally an ability to extend the functionality of the analysis pipeline. At certain stages of the pipeline execution, each of these stages is represented as a “Run Level”.

Configuration

Occasionally, you need to configure plugins before their execution. To do this, the Plugin Framework offers three different caches for storing the configurations for the two different workflows for executing a plugin.

Automated Pipeline Workflow

  • 1st Priority: Plan Configuration
  • 2nd Priority: Global Configuration

Manual Plugin Execution

  • 1st Priority: Instance Configuration
  • 2nd Priority: Global Configuration
Run Levels

One of the key attributes of any given plugin is the run level that directs the pipeline to execute the plugin at each of these stages specified in the module. It is important to remember that the same method is called in the plugin no matter what run level is currently being executed. So if you are going to use more than one run level, write the plugin code so it is conditionally based on the Run Levels.

When employing run levels, use one of the two following strategies. The conventional workflow covers almost all situations; therefore, it is the default approach.

Block Levels

When you use block-based run levels, we recommend that you use a combination of the three following run levels:

  • PRE: This stage occurs before any significant processing happens, and is sufficient for preparation.
  • BLOCK: Plugins are triggered once per block on the chip. This run level is never executed for runs that do not have block-level processing.
  • POST: This stage occurs after the analysis pipeline is completely executed. When executed, the plugin results output directory is a child directory of the normal plugin output directory named “post”.

Conventional Workflow

This strategy is the default for non-block-level specific run levels and is used in a more conventional workflow.

  • DEFAULT: Plugins are triggered at the end of pipeline processing after the four usual steps (see pipeline documentation for details).
  • LAST: Plugins are executed after all other plugins that are not “LAST” have been executed. If there is more than one, all “LAST” run level plugins run concurrently.

Internal Use Only

  • SEPARATOR: Do not use.
Run Types

Run Types define which type of data the plugin is capable of running on. This controls whether the plugin is executed on a specific report type when it is selected during planning. If no run types are defined, the plugin will be launched for thumbnail and Ion PGM™ System reports only. In order to auto-run on Ion GeneStudio™ S5 System/Ion Proton™ System reports, the plugin must include COMPOSITE in its runtypes specification.

  • COMPOSITE: Plugin will run on Ion GeneStudio™ S5 System/Ion Proton™ System report.
  • THUMB: Plugin will run on Ion GeneStudio™ S5 System/Ion Proton™ System thumbnail report.
  • FULLCHIP: Plugin will run on Ion PGM™ System report.
Dependencies

The term “dependency” is not quite accurate. This attribute ensures that when a plugin with a “dependency” is set to run at a run level, it is scheduled to run after the declared dependency that also shares that run level. If the declared dependency is not scheduled to run at the same run level, then the plugin runs without any special scheduling.

OIA Integration

Currently, the “On Instrument Analysis” (OIA) is responsible for the first two portions of the pipeline execution. The OIA does not normally interfere with plugin execution. However, if you select the PRE run level, any OIA-based workflows are executed after the signal processing step. A pure Torrent Suite™ Software implementation’s PRE step is executed before the signal processing step.

Plugin Code

You must write the code for all plugins in python, therefore a basic understanding of both python and object oriented programming is required.

In order for the plugin to function, it must inherit from the base class IonPlugin contained in the module at ion.plugin. At a minimum, the version attribute and launch method need to be overridden.

Legacy Note

Legacy plugins that use a bash script called “launch.sh” are obsolete and should not be replicated.

Naming Your Plugin

It is important to include the name of your plugin in the following:

  • The directory containing the python plugin file

  • The name of the python plugin file (not including the required .py file extension)

  • The name of the class declared within the python plugin file that derives the IonPlugin base class

    NOTE: All are case-sensitive.

Plugin Version

The version of the plugin must be a string that has the standard four-number formatting as follows:

<Major>.<Minor>.<Revision>.<Build>

Launch Method

The one required override method to implement in the plugin class is the launch method, which has only the self argument, and an unused “Data” argument with the “None” default. This method performs all the required actions to achieve the goal of the plugin as well as to produce all the results files.

Packaging & Installation

There are two supported methods for packaging and installing plugins into the system: the debian packaging system and a simple zip archive method. This section describes only the zip archive method. The debian packaging system is described elsewhere because it is more advanced.

When you create a zip package, the contents must use a file structure with a root folder that has the same name as the plugin. All other contents are a child of this root folder:

Linux Bash Shell: ‘zip -r –exclude=*.git* PluginName.zip PluginDirectory’

After you create the archive, go to http://TS_hostname/configure/plugins/ on the Torrent Suite™ Software, then click “Install or Upgrade Plugin” to submit your new archive.

Plugin Reference

Plugin Files

  • Plugin Python File: The primary file for implementing the logic contained in the plugin. The name of this file must be <PluginName>.py and be contained in the top level directory, which also has the same name as the plugin. Names are case-sensitive.
  • Configuration Interfaces: There are three different configuration interfaces, all of which are optional. If your plugin does not require any configuration to execute, you do not need to implement all of the following:
    • instance.html: If present, this page appears when a plugin is run from the Manual Launch button on the Run Report page.
    • plan.html: When you create a plan in the Plugin chevron, you have the option of launching a configuration interface for that plan. If not present, you can still select the plugin to run, but there will be no configuration data.
    • config.html: This interface is presented in the plugin configuration interface and sets up the default configuration, which is used if neither of the other two configuration caches are present.
  • Static Files: HTML files included in or generated by a plugin may need to load static assets (JS/CSS/Images). Include these files in a directory called pluginMedia in the root plugin directory. Reference the static files using the following URL pattern: /pluginMedia/<PluginName>/example.css
  • Documentation:
    • about.html: If present, this information is accessible from the plugins manage menu on the plugin page.

Base Class

All plugins must create one and only one class that inherits from the IonPlugin base class. The IonPlugin base class requires that the following attributes and methods be overridden, although some are optional.

Attributes & Properties
Attribute Name Required Type Default Description
name No string Empty Stores the name of the plugin in addition to the name of the class itself for logging.
version Yes string Empty The four number version number for the plugin.
runtypes No list(string) Empty Indicates if this plugin is used for wholechip and/or thumbnails.
features No list(string) Empty Holds a list of current features enabled for this plugin.
runlevels Yes list(string) Empty Holds a list for each run level that this plugin executes during the pipeline execution.
depends No list(string) Empty Lists all plugins which are executed before this one, if present.
major_block No boolean False If true, indicates that this plugin’s output is presented as part of the run report.
requires No list(string) [‘BAM’] Currently unused.
output No dictionary Empty Currently unused.
results No dictionary Empty Currently unused.
exit_status No int Empty Currently unused.
context No dictionary Empty Currently unused.
blockcount No int 0 Currently unused.
plugin No Plugin None Currently unused.
analysis No Result None Currently unused.
pluginresult No PluginResult None Currently unused.
startplugin No dictionary None This returns “an” in the memory dictionary of the startplugin.json.
Methods
Method Name Required Return Type Description
launch_wrapper No None Do not use.
generate_output No None Currently unused.
pre_block No None Currently unused.
post_block No None Currently unused.
pre_launch No boolean Run prior to launch. Return False if you do not want the plugin to execute.
post_launch No None Currently unused.
launch Yes boolean If true, this indicates that this plugin’s output is presented as part of the run report.
getUserInput No None Currently unused.
barcodetable_columns No list This method returns a list of columns to be used to generate the plugin barcodes table ui.
barcodetable_data No dictionary This returns a dictionary to populate the contents of the plugin barcodes table ui.
get_restobj No dictionary This method returns a dictionary based on a REST API function call.
Enums

Import the enumerations from the ion.plugin.constants module. Since enumerations are not supported in python 2, you implement them by creating a type with static members according to the following scheme.

  • Feature
    • EXPORT: Used to indicate that this plugin is run last because it exports data.
  • Run Types
    • COMPOSITE: Block based chip runs.
    • THUMB: A thumbnail result.
    • FULLCHIP: Ion PGM™ System Full chip results.
  • Run Levels
    • PRE
    • DEFAULT
    • BLOCK
    • POST
    • SEPARATOR
    • LAST

Execution Environment

When you execute plugins, they are controlled with a script which is written to the results output directory call ion_plugin_*<Plugin Name>*_launch.sh. The plugin framework creates this file and directs the Grid Engine to execute this as the entry point for the plugin execution. The file handles the following:

  • Updating the status in the database to be reflected in the run results page
  • Setting up environmental variables (these are used in legacy plugins)
  • Setting the umask to 0000
  • Preventing core files from being written from core dumps
  • Implementing the use of the output.json to create output (currently incomplete)
Run Levels

To use the run levels, you must assign them to your plugin class. If none are assigned the plugin will use DEFAULT runlevel. The run levels, block and conventional, are described in the Getting Started section. While it is technically possible, we do not recommend that you assign run levels from both groups concurrently.

Clusters

To accommplish clustering, the execution of the plugins is queued through a grid engine which, for single servers, is executed on the same computer as the one hosting the web site. In a cluster, the plugins are run only on the computer nodes and never on the head node. Consider the following when writing a plugin:

  • The plugin is not run on the head node, so any references to “localhost” are incorrect. For example, if you are making a REST call and you have hard-coded the domain name of the url to be localhost, this attempts to call the REST API from the compute node, which results in an error. Instead, ensure that any REST API calls use the protocol and domain name in the startplugin.json contents runinfo->net_location.
  • To distribute the executable code to the compute nodes, the system piggy-backs on the commonly shared NFS mount “/results” by creating a child folder at “/results/plugins/”. This means that the stability of the plugin framework is going to be intimately tied to the stability of the network. Ensure that the connection to the results folder is as stable and redundant as reasonably possible.
Dependencies

Due to the method of distribution of plugin logic over NFS mounts, there are very few libraries on the compute nodes during run time. To work around this, package all dependencies (beyond the standard python libraries) into the install file with the core logic so they are also installed into the /results/plugins/<Plugin Name> directory on the NFS mount to be redistributed out to the compute nodes.

REST API Extensions

The plugin framework currently gives you an option of extending the REST API with custom endpoints by implementing a python file in the root of the plugin folder, which must have the name “extend.py”. By implementing a method in this module with a single dictionary argument named “bucket”, which is described below, the extension is exposed through the REST API for execution using the following url:

http(s)://{HOSTNAME}/rundb/api/v1/plugin/{PLUGIN}/extend/{METHOD_NAME}

bucket["request_get"] = request.GET
# assume json
if request.method == "POST":
    bucket["request_post"] = json.loads(request.body)
bucket["user"] = request.user
bucket["request_method"] = request.method
bucket["name"] = plugin.name
bucket["version"] = plugin.version
# not sure if we want this or not, keep it for now
bucket["config"] = plugin.config

Configuration

In many situations for plugins, there needs to be some sort of configuration declared before the plugin run time. This means that the plugin needs to implement an interface to allow users to configure it. Users can select from three configuration options in Torrent Suite™ Software: global, plan, and manual. The HTML pages can reference static assets, see Plugin Files.

Global Configuration

Include an HTML file named config.html in your root plugin directory to enable global configuration. This HTML window appears in an iframe on the global plugin configuration page at /configure/plugins/. Click the gear_icon (Settings) next to a plugin, then select “Configure”.

Reading Configuration

Read from the plugin api endpoint. “/rundb/api/v1/plugin/” + TB_plugin.pk + “/” Or Read the window.TB_plugin js variable.

Writing Configuration

Write to the plugin api endpoint with a PUT request. “/rundb/api/v1/plugin/” + TB_plugin.pk + “/”

Plan Configuration

Include an HTML file named plan.html in your root plugin directory to enable plan configuration. This HTML window appears in an iframe on the planning screen plugin configuration page at /plan/page_plan_plugins/. Click the checkbox next to a plugin, then select “Configure”.

Reading Configuration

Read the window.TB_plugin js variable, then wait for window.restoreForm to be called with the last data passed to serializeForm.

Writing Configuration

window.serializeForm is called by the parent frame to gather the current configuration when users click “Save” in the parent frame.

Manual Configuration

Include an HTML file named instance.html in your root plugin directory to enable manual configuration. The HTML window appears in an iframe on the report page at /report/<ID>/. Click “Select Plugins To Run”, then select a plugin.

Reading Configuration

Read the window. TB_plugin js variable.

Writing Configuration

Write to the results endpoint with a POST request. “/rundb/api/v1/results/” + TB_result + “/plugin/” Then call the following to close the iframe. window.parent.$.colorbox.close()

Barcode Table UI

Plugin Barcode Table UI is an optional service provided by the plugin framework. It allows plugins to generate a simple GUI that can be used to select which barcodes to process and specify per-barcode parameters. The table is similar to the barcode sample table in plan screen with one row per barcode and columns specified by the plugin. This UI is provided for manual plugin launch only and is an opt-in service for plugins to use if desired.

Defining table columns

def barcodetable_columns(self):
    # plugin class method to specify which columns to display
    # inputs: none
    # outputs: list of columns and options to show
    columns_list = [
        {
            "field": "selected",
            "editable": True
        },
        {
            "field": "barcode_name",
            "editable": False
        },
        {
            "field": "sample",
            "editable": False
        },
        ...
    ]
    return columns_list

List of available columns can be retrieved from framework by executing the following command line:

python /results/plugins/<myPlugin>/<myPlugin>.py --bctable-columns

Providing default table contents (optional)

Plugin barcode table will be populated on page load from existing samples information entered during run planning. Additionally, the plugin can modify or augment this initial data if it specifies the following function:

def barcodetable_data(self, data, planconfig={}, globalconfig={}):
    # plugin class method to specify default table contents
    # inputs:
    #    data - same structure as in barcodes.json
    #    planconfig - plugin configuration from planning (plan.html)
    #    globalconfig - plugin global configuration (config.html)
    # outputs:
    #    data, modified as needed
    return data

Changing instance.html

The plugin’s instance.html must add the contents of barcodes table to the plugin data before POSTing it to the results API. This data will be written to startplugin.json file at plugin runtime under “pluginconfig” section.

Helper TB_plugin_functions js variable is available to interact with the barcode table UI:

  • TB_plugin_functions.get_plugin_barcodetable()
    returns table data as json object
  • TB_plugin_functions.update_plugin_barcodetable(data)
    can be used to update the table with data json object
  • TB_plugin_functions.plugin_barcodetable_div
    barcode table DIV element

Input Files

The plugin framework creates two different files for general plugin consumption as its inputs. The variables, which are communicated to the plugin from the framework, are spread across two separate JSON files.

barcodes.json

This file has all the references required for iterating through all of the barcodes for a particular run.

Developer Option

By default all the barcodes where the filtered key is true are not included in the barcodes.json file. You can overwrite this behavior by adding “PLUGINS_INCLUDE_FILTERED_BARCODES = True” to the local_settings.py and restarting the ionPlugin service.

nonbarcoded: {
    aligned <bool>: Flags if the reads in bam_file are aligned to the reference genome.
    bam_file <string>: Name of reads file. (May or may not be be aligned to the reference.)
    bam_filepath <string>: Full file path to bam_file on the local torrent server. (File may not exist if read_count is 0.)
    control_sequence_type <string>: Currently either ERCC Mix 1 or ERCC Mix 2 and only defined in plan screen for RNA Sequencing. (Purpose unspecified.)
    filtered <bool>: Flags if the barcode passed the |TS| analysis pipeline filtering criteria.
    hotspot_filepath <string>: Full file path to HotSpot target regions (BED) file on the local torrent server. ("" if not used.)
    genome_urlpath <string>: URL path used to specify the genome for applications like IGV. Typically the path to the FASTA file on the local torrent server.
    nucleotide_type <string>: Currently either DNA or RNA depending on application. Primarily used to distinguish barcodes with AmpliSeq DNA+RNA runs.
    read_count <int>: Total number of barcode-assigned reads in bam_file (prior to alignment).
    reference <string>: Common (short) name of the reference genome used in the pipeline for this barcode, e.g. hg19
    reference_fullpath <string>: Full file path to the to the reference sequences in FASTA format on the local torrent server. (May be "" for unaligned reads.)
    sample <string>: Name of the sample associated with this barcode. (May be associated with multiple barcodes.)
    sample_id <string>: Sample identification code associated with sample.
    target_region_filepath <string>: Full file path to target regions (BED) file on the local torrent server. ("" if not used.)
}
barcode_name: {
    aligned <bool>: Flags if the reads in bam_file are aligned to the reference genome.
    bam_file <string>: Name of reads file. (May or may not be be aligned to the reference.)
    bam_filepath <string>: Full file path to bam_file on the local torrent server.
    barcode_adapter <string>: DNA adapter sequence used to separate barcode_sequence from sequenced read.
    barcode_annotation <string>: User-specified annotation for this barcode.
    barcode_description <string>: Description text associated with this barcode.
    barcode_index <int>: Index of barcode in the barcode set, starting at 1.
    barcode_name <string>: Name of the barcode in the barcode set (barcode_name).
    barcode_sequence <string>: DNA sequence used to identify this barcode.
    barcode_type <string>: User-specified type for this barcode.
    control_sequence_type <string>: Currently either ERCC Mix 1 or ERCC Mix 2 and only defined in plan screen for RNA Sequencing. (Purpose unspecified.)
    filtered <bool>: Flags if the barcode passed the |TS| analysis pipeline filtering criteria.
    hotspot_filepath <string>: Full file path to HotSpot target regions (BED) file on the local torrent server. ("" if not used.)
    genome_urlpath <string>: URL path used to specify the genome for applications like IGV. Typically the path to the FASTA file on the local torrent server.
    nucleotide_type <string>: Currently either DNA or RNA depending on application. Primarily used to distinguish barcodes with AmpliSeq DNA+RNA runs.
    read_count <int>: Total number of barcode-assigned reads in bam_file (prior to alignment).
    reference <string>: Common (short) name of the reference genome used in the pipeline for this barcode, e.g. hg19
    reference_fullpath <string>: Full file path to the to the reference sequences in FASTA format on the local torrent server. (May be "" for unaligned reads.)
    sample <string>: Name of the sample associated with this barcode. (May be associated with multiple barcodes.)
    sample_id <string>: Sample identification code associated with sample.
    target_region_filepath <string>: Full file path to target regions (BED) file on the local torrent server. ("" if not used.)
}

Example barcodes.json for a barcoded run (TSS v5.0.3)
{
   "IonXpress_001":{
      "aligned":true,
      "bam_file":"IonXpress_001_rawlib.bam",
      "bam_filepath":"/results/analysis/output/Local/with_many_samples_017/IonXpress_001_rawlib.bam",
      "barcode_adapter":"GAT",
      "barcode_annotation":"",
      "barcode_description":"",
      "barcode_index":1,
      "barcode_name":"IonXpress_001",
      "barcode_sequence":"CTAAGGTAAC",
      "barcode_type":"",
      "control_sequence_type":"",
      "filtered":false,
      "genome_urlpath":"/auth/output/tmap-f3/hg19/hg19.fasta",
      "hotspot_filepath":"",
      "nucleotide_type":"DNA",
      "read_count":20,
      "reference":"hg19",
      "reference_fullpath":"/results/referenceLibrary/tmap-f3/hg19/hg19.fasta",
      "sample":"First Sample name",
      "sample_id":"",
      "target_region_filepath":""
   },
   "IonXpress_033":{
      "aligned":true,
      "bam_file":"IonXpress_033_rawlib.bam",
      "bam_filepath":"/results/analysis/output/Local/with_many_samples_017/IonXpress_033_rawlib.bam",
      "barcode_adapter":"GAT",
      "barcode_annotation":"",
      "barcode_description":"",
      "barcode_index":33,
      "barcode_name":"IonXpress_033",
      "barcode_sequence":"TTCTCATTGAAC",
      "barcode_type":"",
      "control_sequence_type":"",
      "filtered":false,
      "genome_urlpath":"/auth/output/tmap-f3/hg19/hg19.fasta",
      "hotspot_filepath":"",
      "nucleotide_type":"DNA",
      "read_count":231321,
      "reference":"hg19",
      "reference_fullpath":"/results/referenceLibrary/tmap-f3/hg19/hg19.fasta",
      "sample":"Second Sample Name",
      "sample_id":"",
      "target_region_filepath":""
   },
   "IonXpress_034":{
      "aligned":true,
      "bam_file":"IonXpress_034_rawlib.bam",
      "bam_filepath":"/results/analysis/output/Local/with_many_samples_017/IonXpress_034_rawlib.bam",
      "barcode_adapter":"GAT",
      "barcode_annotation":"",
      "barcode_description":"",
      "barcode_index":34,
      "barcode_name":"IonXpress_034",
      "barcode_sequence":"TCGCATCGTTC",
      "barcode_type":"",
      "control_sequence_type":"",
      "filtered":false,
      "genome_urlpath":"/auth/output/tmap-f3/hg19/hg19.fasta",
      "hotspot_filepath":"",
      "nucleotide_type":"",
      "read_count":267041,
      "reference":"hg19",
      "reference_fullpath":"/results/referenceLibrary/tmap-f3/hg19/hg19.fasta",
      "sample":"",
      "sample_id":"",
      "target_region_filepath":""
   }
}

Usage Notes

  1. For consistency, we recommend that you iterate and present barcodes in order of increasing barcode_index value.
  2. For default plugin configurations, barcodes with filtered == true are not output. (A plugin option to include these may become available soon.)
  3. Barcodes with a sample name provided (i.e. not “”) are represented with filtered == false, regardless of read_count value.
  4. The bam_filepath value is set to the expected location of the bam_file on the Torrent Server. Barcodes with read_count == 0 may not have a bam_file saved, so you can expect a failure to find the bam_file at bam_filepath. If read_count > 0 then a missing bam_file should be treated as an unexpected error. (This would most likely be a result of automated deletion of old files to make space on the server.)
  5. Although control_sequence_type and nucleotide_type appear to be general attributes, at 5.0.3 these are only defined for barcodes that were specified (associated with samples) in the plan. For nonbarcoded elements or barcodes with no sample data that had sufficient reads. these attributes have the value “”.
startplugin.json

This is the primary file to get all of the information regarding the file.

{
    chefSummaary <dictionary> : This optional section will convey information regarding the chef parameters used. {
    }
    datamanagement <dictionary>: Holds information regarding the data management state of the run. {
        Basecalling Input <bool>: This will indicate if the basecalling information is available for use.
        Intermediate Files <bool>: This will indicate if the intermediate files are available for use.
        Output Files <bool>: This will indicate if the output files are available for use.
        Signal Processing Input <bool>: This will indicate if the signal processing information is available for use.
    }
    expmeta <dictionary>: This is an aggregate of data contained in the expMeta.dat file and the ion_params_00.json file. {
        analysis_date <date>: Gets the time of results analysis based on the last modified time stamp on the ion_params_00.json file.
        barcodeId <string>: The barcode kit name from the experiment analysis settings.
        chipBarcode <string>: The barcode of the chip derived from the ion_params_00.json->exp_json->chipBarcode... mostly.
        chiptype <string>: This is the chip which was used to do the run.
        flowOrder <string>: The flow order used to sequence the run.
        instrument <string>: The name (not type) of the instrument which was used to do the sequencing.
        notes <string>: Any notes which may have been included in the experiment.
        project <string>: A list of all of the projects which this result may belong to.
        results_name <string>: The name of the results that will be processed.
        run_date <datetime>: The date/time stamp of the experiment.
        run_flows <int>: The number of flows used in the run.
        run_name <string>: The name of the run as opposed to the name of the result.
        runid <string>: A short identifies for each id.
        sample <string>: This is the name of the first sample which is associated with this run.
        output_file_name_stem <string>: This is a merger of the experiment name and the results name.
    }
    globalconfig <dictionary>: This section is for the global environment of the result. {
        MEM_MAX <string>: Hardcoded to always read "15G".
        debug <int>: Hardcoded to always read 0.
    }
    plan <dictionary>: This section is where all of the elements of the experiment plan are stored. {
        barcodeId <string>: The barcode kit name from the experiment analysis settings.
        barcodedSamples <dictionary>: This is a dictionary of all of the samples information and the barcodes they are associated with. {
            -Sample Name- <dictionary>: The name of the sample {
                barcodeSampleInfo <dictionary>: Contains the information for the barcodes. {
                    -Barcode ID- <dictionary>: {
                        controlSequenceType <string>: The name of the kit used for the controls for specific per Sample applications.
                        controlType <string>: The experimental control used for this sample. eg (No Template Control)
                        description <string>: Free form description field.
                        externalId <string>: Free form id from any external sources
                        hotSpotRegionBedFile <string>: The name of the hotspot data used for this sample.
                        nucleotideType <string>: This will be the nucleotideType used for this barcode (DNA/RNA/Fusions).
                        reference <string>: The name of the reference
                        sseBedFile <string>: The SSE Bed file reference.
                        targetRegionBedFile <string>: The name of the target region data used for this sample.
                    }
                }
                barcodes <list>: A list of strings which should only have one entry equal to the single dictionary key for barcodeSampleInfo.
            }
        }
        bedfile <string>: The name of a bed file used in this plan.
        controlSequencekitname <string, nullable>: The name of the kit used for the controls.
        librarykitname <string>: The name of the library kit used in the plan.
        planName <string>: The name of the plan used in the run.
        regionfile <string>: The file to define regions for this plan.
        reverse_primer <string>: The reverse primer used in the plan.
        runMode <string>: The run mode value of 'SingleRead', 'PairedEnd' or 'Undefined'
        runType <string>: The type of sequencing for this plan, for example "GENS"
        runTypeDescription <string> : A plain english description of the run type, for example "Generic Sequencing".
        sampleGrouping <dictionary>: A representation of the sample group.
        samplePrepKitName <string>: The name of the sample prep kit.
        sampleSet_name <string>: The name of the sample set.
        sampleSet_planIndex <int>: deprecated
        sampleSet_planTotal <int>: deprecated
        sampleSet_uid <string>: deprecated
        sampleTubeLabel <string>: The barcode sample prep label on the sample tube.
        sequencekitname <string>: The name of the kit used for sequencing.
        templatingKitName <string>: The name of the kit used for templating.
        threePrimeAdapter <string>: The sequence of the three prime adapter being used.
        username <string>: The name of the user who created the plan.
    }
    runinfo <dictionary>: Information regarding the sequencing run. {
        alignment_dir <string>: The path of the directory with the alignment data.
        analysis_dir <string>: The path of the directory using the Analysis data.
        api_key <string>: The api key which can be used to access the
        api_url <string>: The base directory url for *most* of the rest api calls.
        barcodeId <string>: The identifier for the barcoding kit.
        basecaller_dir <string>: The path to the directory with the basecaller information.
        chipDescription <string>: The description of the chip used for sequencing.
        chipType <string>: The type of the chip used for sequencing.
        library <string>: The reference library used.
        library_key <string>: The key sequence to the library.
        net_location <string>: The url to the master node used for the run.
        pk <int>: The primary key for this run in the database.
        platform <string>: The type of sequencer being used.
        plugin <dictionary>: This section describes the run parameters for this plugin in this run. {
            depends <list>: The list of dependency plugins for this run.
            features <list>: The list of features for this plugin.
            hold_jid <list>: A list of SGE job id's which this process was asked to hold on.
            id <int>: The database pk for the id of the plugin.
            name <string>: The name of this plugin.
            path <string>: The path to the plugin executable directory.
            pluginconfig <dictionary>: This is a freeform dictionary which contains the global configuration used for this plugin run.
            pluginresult <int>:  The database primary key for the plugin results entry.
            results_dir <string>: The directory path to the plugin result output.
            runlevel <list>: The list of run levels this plugin has been asked to run at.
            runtype <list>: This list of run types that this plugin can be run on.
            userInput <dictionary>: This is a freeform dictionary which contains the run configuration used for this plugin run.
            version <string>: The version of the plugin running.
        }
        plugin_dir <string>: The path to the plugin executable directory.
        plugin_name <string>: The name of this plugin.
        pluginresult <int>: The database primary key for the plugin results entry.
        raw_data_dir <string>: The path to the directory which contains the raw observational data.
        report_root_dir <string>: The path to the directory of the report.
        results_dir <string>: The path to the directory of the plugin results.
        sigproc_dir <string>: The path to the directory of the signal processing data.
        systemType <string>: The type of sequencer being used.
        testfrag_key <string>: The sequence key to the test fragments.
        tmap_version <string>: The version of the tmap program being used.
        url_root <string>: The file path to the directory of the results data. (not a url)
        username <string>: The user who is performing the run.
    {
    runplugin <dictionary>: The exact parameters used for this plugin run. {
        blockId <string>: The id for the block currently being processed.  Blank if not a block process.
        block_dirs <list>: A list of all of the directories of all of the block data.
        numBlocks <int>: The total number of blocks processed.
        run_mode <string>: The run mode that this is being processed in, either 'pipeline' or 'manual'.
        run_type <string>: The type of the run.  Thumbnail, wholechip or composite.
        runlevel <string>: The current run level being run.
    }
    sampleinfo <dictionary>: A dictionary of information used to convey information regarding the samples. {
        SampleName <dictionary>: The name of the sample. {
            attributes <dictionary>: Any attributes {
            }
            description <????>: A free form description of the sample.
            displayedName <string>: The name of the sample.
            externalId <string>: Any remote identifier used for the sample.
            name <string>: The name of the sample without whitespace.
        }
    pluginconfig <dictionary>: This is a freeform dictionary which contains the run configuration used for this plugin run. {
    }
}

Example
{
    "datamanagement": {
        "Basecalling Input": true,
        "Intermediate Files": true,
        "Output Files": true,
        "Signal Processing Input": true
    },
    "expmeta": {
        "analysis_date": "2015-09-02",
        "barcodeId": "",
        "chipBarcode": "AA0026665",
        "chiptype": "\"314R\"",
        "flowOrder": "TACGTACGTCTGAGCATCGATCGATGTACAGC",
        "instrument": "PGM_test",
        "notes": "",
        "project": "SampleData",
        "results_name": "Auto_user_CB1-42-r9723-314wfa-tl_36",
        "run_date": "2011-04-07T12:44:38Z",
        "run_flows": 260,
        "run_name": "R_2011_04_07_12_44_38_user_CB1-42-r9723-314wfa-tl",
        "runid": "ZN2MB",
        "sample": "e5272-wfa-l165"
    },
    "globalconfig": {
        "MEM_MAX": "15G",
        "debug": 0
    },
    "plan": {
        "barcodeId": "",
        "barcodedSamples": {},
        "bedfile": "",
        "controlSequencekitname": null,
        "librarykitname": "Ion Xpress Plus Fragment Library Kit",
        "planName": "CopyOfSystemDefault_R_2011_04_07_12_44_38_user_CB1-42-r9723-314wfa-tl",
        "regionfile": "",
        "reverse_primer": null,
        "runMode": "single",
        "runType": "GENS",
        "runTypeDescription": "",
        "sampleGrouping": null,
        "samplePrepKitName": null,
        "sampleSet_name": null,
        "sampleSet_planIndex": 0,
        "sampleSet_planTotal": 0,
        "sampleSet_uid": null,
        "sampleTubeLabel": null,
        "sequencekitname": "IonPGM200Kit-v2",
        "templatingKitName": "Ion PGM Template OT2 200 Kit",
        "threePrimeAdapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
        "username": string
    },
    "pluginconfig": {},
    "runinfo": {
        "alignment_dir": "/results/analysis/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001",
        "analysis_dir": "/results/analysis/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001",
        "api_key": "9516e00c170496012b6df5810431aca7ac558163",
        "api_url": "http://ion-ts-vm/rundb/api",
        "barcodeId": "",
        "basecaller_dir": "/results/analysis/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001/basecaller_results",
        "chipDescription": "",
        "chipType": "\"314R\"",
        "library": "e_coli_dh10b",
        "library_key": "TCAG",
        "net_location": "http://ion-ts-vm",
        "pk": 1,
        "platform": "pgm",
        "plugin": {
            "depends": [],
            "features": [],
            "hold_jid": [],
            "id": 11,
            "name": "FilterDuplicates",
            "path": "/results/plugins/FilterDuplicates",
            "pluginconfig": {},
            "pluginresult": 5,
            "results_dir": "/results/analysis/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001/plugin_out/FilterDuplicates_out.5",
            "runlevel": [],
            "runtype": [
                "composite",
                "wholechip",
                "thumbnail"
            ],
            "userInput": "",
            "version": "5.0.0.0"
        },
        "plugin_dir": "/results/plugins/FilterDuplicates",
        "plugin_name": "FilterDuplicates",
        "pluginresult": 5,
        "raw_data_dir": "/results/PGM_test/cropped_CB1-42",
        "report_root_dir": "/results/analysis/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001",
        "results_dir": "/results/analysis/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001/plugin_out/FilterDuplicates_out.5",
        "sigproc_dir": "/results/analysis/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001/sigproc_results",
        "systemType": "pgm",
        "testfrag_key": "ATCG",
        "tmap_version": "tmap-f3",
        "url_root": "/output/Disabled/Auto_user_CB1-42-r9723-314wfa-tl_36_001",
        "username": "ionadmin"
    },
    "runplugin": {
        "blockId": "",
        "block_dirs": [
            "."
        ],
        "numBlocks": 1,
        "run_mode": "manual",
        "run_type": "wholechip",
        "runlevel": "default"
    },
    "sampleinfo": {
        "e5272-wfa-l165": {
            "attributes": {},
            "description": null,
            "displayedName": "e5272-wfa-l165",
            "externalId": "",
            "name": "e5272-wfa-l165"
        }
    }
}
Seq Files (BAMs)

The actual sequence information is a critical portion of all of the plugins running information. When you attempt to access them, refer to the barcodes.json file for references to their path in the “bam_filepath” key.

Output Files

The primary output of all of the plugins is the report HTML file, which is produced by the plugin. Name this file *_block.html or *_block.php. There can be any number of them, and they are all displayed in separate iFrames. If plugin output doesn’t contain a _block.html or _block.php file then all HTML/PHP files in the plugin result folder will be shown as links in the plugin section.

Additionally, the SGE produces a log file for recording the standard output of the plugin execution, which is called drmaa_stdout.txt. This contains all the information printed from the controlling script, including the standard output of the plugin itself, and is a primary source of information for debugging.

See Rendering Templates for an example using HTML templates. This usually results in cleaner code than assembling large strings or multiple-file writes.

File Permissions

The SGE executes all of the plugins as the user ‘ionian’ to perform the execution. All files produced have both the owner and group of ionian and full read/write access to the plugin result directory. This also includes the ability to create new directories. The plugins have only read access to all other files, most notably the file in the run results directory.

Upgrades

When upgrading the plugins, after all of the changes have been made to the logic of plugin, all you need to do is to increment the version of the plugin and repackage the plugin for deployment.

Plugin Examples

This section has a very basic example plugin and its code.

Basic Plugin

This plugin goes through the explog and presents a few entries in the plugin output. It produces an HTML output but does not take any parameters.

#!/usr/bin/python
# Copyright (C) 2018 Thermo Fisher Scientific, Inc. All Rights Reserved

#
# Samples: LogParser
# plugin demonstrating simple log parsing ability
#

import json
import os
from django.utils.functional import cached_property
from ion.plugin import *


class LogParser(IonPlugin):
    # The version number for this plugin
    version = "5.4.0.0"

    # this plugin can run on fullchip runs, thumbnail runs, and composite (merged via project page) runs
    # when this plugin is manually launched, only the 'launch' method is called
    runtypes = [RunType.FULLCHIP, RunType.THUMB, RunType.COMPOSITE]

    # specify when the plugin is called.  For log parsing, stay simple and just get called when the run completes.
    # the plugin can also be called before the run starts, at the block level, or after all other default plugins run
    runlevels = [RunLevel.DEFAULT]

    # a simple cached version of the start plugin property
    @cached_property
    def startplugin_json(self):
        return self.startplugin

    def read_explog(self):
        """This method reads and outputs an array of colon-delimited key/value pairs from the explog_final.txt"""

        path = os.path.join(self.startplugin_json['runinfo']['raw_data_dir'], "explog_final.txt")
        if not os.path.exists(path):
            raise Exception("explog_final.txt missing")

        # parse the log file for all of the values in a colon-delimited parameter
        data = dict()
        for line in open(path):
            # accommodates formatting issues in explog
            datum = line.split(":", 1)
            if len(datum) == 2:
                key, value = datum
                data[key.strip()] = value.strip()

        return data

    def launch(self, data=None):
        """This is the primary launch method for the plugin."""

        na = '<strong>NA</strong>'
        # creates a results object that is written out later.  This holds data that can be scrapped by a LIMS system,
                    and will be part of the |TS| database
        exp_log_data = self.read_explog()
        results_json = {
            'Project': exp_log_data.get('Project', None) or na,
            'Sample': exp_log_data.get('Sample', None) or na,
            'Library': exp_log_data.get('Library', None) or na,
        }

        # open up an HTML file to dump interesting log file findings to
        with open(self.startplugin_json['runinfo']['results_dir'] + '/LogParser_block.html', 'w') as html_handle:
            html_handle.write('<html><body>')
            html_handle.write("Project is: %s<br \>" % results_json['Project'])
            html_handle.write("Sample is: %s<br \>" % results_json['Sample'])
            html_handle.write("Library is: %s<br \>" % results_json['Library'])
            html_handle.write('</body></hmtl>')

        # write out our results json object
        with open(self.startplugin_json['runinfo']['results_dir'] + '/results.json', 'w') as results_handle:
            json.dump(results_json, results_handle, indent=4)

        return True

# Devel use - running directly
if __name__ == "__main__":
    PluginCLI()
Plugin which uses a subprocess
#!/usr/bin/python
# Copyright (C) 2018 Thermo Fisher Scientific, Inc. All Rights Reserved

#
# Samples: LogParser
# plugin demonstrating simple log parsing ability
#

import json
import os
from django.utils.functional import cached_property
from ion.plugin import *
from subprocess import check_output


class CallSubprocessExample(IonPlugin):
    # The version number for this plugin
    version = "5.4.0.0"

    # this plugin can run on fullchip runs, thumbnail runs, and composite (merged via project page) runs
    # note that when the plugin is manually launched, only the 'launch' method will be called
    runtypes = [RunType.FULLCHIP, RunType.THUMB, RunType.COMPOSITE]

    # specify when the plugin is called.  For log parsing, stay simple and just get called when the run completes.
    # but can also be called before the run starts, at the block level, or after all other default plugins run
    runlevels = [RunLevel.DEFAULT]

    # a simple cached version of the start plugin property
    @cached_property
    def startplugin_json(self):
        return self.startplugin

    def launch(self, data=None):
        """This is the primary launch method for the plugin."""

        path_to_executable = "MyExecutable"
        arg1 = 'First Argument'
        arg2 = 'Second Argument'
        results = check_output([path_to_executable, arg1, arg2], cwd=self.startplugin_json['runinfo']['plugin']['path'])

        return True

# Devel use - running directly
if __name__ == "__main__":
    PluginCLI()

Accessing Barcode Data

#!/usr/bin/python
# Copyright (C) 2018 Thermo Fisher Scientific, Inc. All Rights Reserved

#
# Samples: LogParser
# plugin demonstrating simple log parsing ability
#

import json
import os
from django.utils.functional import cached_property
from ion.plugin import *
from subprocess import check_output


class BarcodesExample(IonPlugin):
    # The version number for this plugin
    version = "5.4.0.0"

    # this plugin can run on fullchip runs, thumbnail runs, and composite (merged via project page) runs
    # note that when the plugin is manually launched, only the 'launch' method will be called
    runtypes = [RunType.FULLCHIP, RunType.THUMB, RunType.COMPOSITE]

    # specify when the plugin is called.  For log parsing, stay simple and just get called when the run completes.
    # but can also be called before the run starts, at the block level, or after all other default plugins run
    runlevels = [RunLevel.DEFAULT]

    # a simple cached version of the start plugin property
    @cached_property
    def startplugin_json(self):
        return self.startplugin

    @cached_property
    def barcodes_json:
        with open('barcodes.json', 'r') as barcodes_handle:
            return json.load(barcodes_handle)

    def launch(self, data=None):
        """This is the primary launch method for the plugin."""

        for barcode_name, barcode_values in self.barcodes_json.iteritems():
            # do you work per barcode here!
            print("Barcode Name: " + barcode_name)
            print("Bam File: " + barcode_values['bam_file']

        return True

# Devel use - running directly
if __name__ == "__main__":
    PluginCLI()

Using the REST API

import json
import requests
api_response = requests.get('http://HOSTNAME/APPNAME/api/v1/APIENDPOINT/?ARG1=VAL1&pluginresult=self.startplugin['runinfo']['pluginresult']&api_key=' + self.startplugin['runinfo']['api_key'])
api_response.raise_for_status()
api_json_response = json.loads(api_response.content)

Note: api-key is tied to the specific plugin run so the system must also get which “pluginresult” is sending the API request.

Example 1: How to get the installed annotation files during the plugin execution?

#!/usr/bin/env python
# -*- coding: utf-8 -*-
# Copyright (C) 2018 Thermo Fisher Scientific, Inc. All Rights Reserved

import os
import sys
import requests
import json

from ion.plugin import RunType, PluginCLI, IonPlugin

API_VER = '/v1'

class PluginApiTest(IonPlugin):
    """
       This will make REST api call to get the installed annotation files
       with 'api_key' corresponding to the specific plugin run
    """

    version = "1.0"
    runtypes = [RunType.THUMB, RunType.FULLCHIP]

    def launch(self):
        sp_json_fpath = os.path.join(
            os.environ.get('RESULTS_DIR', ''),
            'startplugin.json'
        )

        with open(sp_json_fpath, 'r') as sp_fh:
            sp_json = json.load(sp_fh)

        endpoint = '/content'
        auth_params = {
            'api_key': sp_json['runinfo']['api_key'],
            'pluginresult': sp_json['runinfo']['pluginresult'],
        }
        query_params = {
            'type': 'Annotation'
        }
        request_params = {}
        request_params.update(auth_params)
        request_params.update(query_params)

        url = sp_json['runinfo']['api_url'] + API_VER + endpoint
        resp = requests.get(url, params=request_params)
        if resp:
            print(resp.url)
            print(resp.json())
            sys.exit(0)
        else:
            print(resp.status_code)
            sys.exit(1)


if __name__ == "__main__":
    PluginCLI()

Example 2: Use the below query_params to list all the files of mm10 auxiliary references for RNASeqAnalysis. Please note the type of camelcase, AuxiliaryReference.

...
query_params = {
    'application_tags__icontains' : 'RNA',
    'extra':'mm10',
    'type' :'AuxiliaryReference'
}
...

Displaying Progress

When displaying progress, this needs to be manually updated by re-writing the *_block.html file intermittently during the process. Here is a simple example of how to construct a method to do this.

...
def update_progress(self, current_progress, max_progress)
    with open(self.startplugin['runinfo']['results_dir'] + '/progress_block.html', 'w') as html_handle:
            html_handle.write('<html><body>')
            html_handle.write("The current progress is %d of %d" %(current_progress, max_progress))
            html_handle.write('</body></hmtl>')
...

Rendering Templates

When outputting HTML files, using templates can be cleaner than assembling long strings. Below is an example of using Django templates. This example uses an HTML template named progress_block_template.html inside a templates directory inside the plugins root directory.

from django.conf import settings
from django.template.loader import render_to_string

settings.configure(TEMPLATE_DIR=self.startplugin["runinfo"]["plugin"]["path"] + '/templates')

with open(self.startplugin['runinfo']['results_dir'] + '/progress_block.html', 'w') as html_handle:
    html_handle.write(render_to_string("progress_block_template.html", {"current_progress": 54}))

Torrent Suite™ Software REST API

This section describes all of the REST API end points that Torrent Suite™ Software makes available and the ways in which you access them.

Getting Started with the API

API Overview

Our API is RESTful and HTTP based. All resources use HTTP standard verbs return JSON data.

The main API endpoint for Torrent Suite™ Software is /rundb/api/v1/. This endpoint returns a JSON object containing information for each resource available from the API. To see each resource’s list endpoint, go to /rundb/api/v1/resource-name/ . To see each resource’s schema, go to /rundb/api/v1/resource-name/schema/.

Authentication

To use the API you need to authenticate as an existing Torrent Suite™ Software user. To see API keys for each Torrent Suite™ Software user, go to /admin/tastypie/apikey/ . You must include an API key with every API request. There are two methods:

As a header. Format is Authorization: ApiKey <username>:<api_key> Authorization: ApiKey daniel:204db7bcfafb2deb7506b89eb3b9b715b09905c8

As GET params http://127.0.0.1:8000/api/v1/entries/?username=daniel&api_key=204db7bcfafb2deb7506b89eb3b9b715b09905c8

Sorting

Use the order_by GET param to specify a field to sort returned objects. Add a - character in front of the field name to switch the sort direction from ascending order (the default) to descending order. You can use most fields of an object to sort.

Filtering

Perform basic filtering by using a GET param with the same name as an object field. Using name=alexander only returns objects with a name field of “alexander”.

Use more advanced filters by appending the correct suffix to the GET param. The suffix consists of __ plus one of the filters that follow. Using name__startswith=alex only returns objects with a name field starting with “alex”.

Filter Description
exact Exact match.
iexact Case-insensitive exact match.
contains Case-sensitive containment test.
icontains Case-insensitive containment test.
in In a given list. Comma delimited.
gt Greater than.
gte Greater than or equal to.
lt Less than.
lte Less than or equal to.
startswith Case-sensitive starts-with.
istartswith Case-insensitive starts-with.
endswith Case-sensitive ends-with.
iendswith Case-insensitive ends-with.
range Range test (inclusive).
year Exact year match (date fields).
month Exact month number match (date fields).
day Exact day number match (date fields).
week_day Exact week day number match. 1-7. Sunday=1 (date fields).
hour Exact hour match. 0-23. (date fields).
minute Exact minute match. 0-59. (date fields).
second Exact second match. 0-59. (date fields).
isnull Null check. True or False.
regex Case-sensitive regular expression match.
iregex Case-insensitive regular expression match.

API Reference

This section has automatically generated reference pages for each endpoint the REST API provides.

Active Ion Chef Library Prep Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activeioncheflibraryprepkitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activeioncheflibraryprepkitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activeioncheflibraryprepkitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "IC",
            "kitType": "LibraryPrepKit",
            "description": "Precision ID Chef DL8",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "",
            "chipTypes": "",
            "runMode": "",
            "parts": [
                {
                    "barcode": "A32926C",
                    "id": 20245,
                    "resource_uri": "/rundb/api/v1/kitpart/20245/",
                    "kit": "/rundb/api/v1/kitinfo/20105/"
                },
                {
                    "barcode": "A33212",
                    "id": 20261,
                    "resource_uri": "/rundb/api/v1/kitpart/20261/",
                    "kit": "/rundb/api/v1/kitinfo/20105/"
                }
            ],
            "flowCount": 0,
            "applicationType": "AMPS",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activeioncheflibraryprepkitinfo/20105/",
            "uid": "LPREP0003",
            "id": 20105,
            "categories": "filter_s5HidKit",
            "name": "Ion Chef HID Library V2"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Active Ion Chef Prep Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activeionchefprepkitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activeionchefprepkitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 9,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activeionchefprepkitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "IC",
            "kitType": "IonChefPrepKit",
            "description": "Precision ID Chef Reagents",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "S5",
            "chipTypes": "510;520;530",
            "runMode": "",
            "parts": [
                {
                    "barcode": "A32882C",
                    "id": 20246,
                    "resource_uri": "/rundb/api/v1/kitpart/20246/",
                    "kit": "/rundb/api/v1/kitinfo/20106/"
                }
            ],
            "flowCount": 0,
            "applicationType": "AMPS",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activeionchefprepkitinfo/20106/",
            "uid": "ICPREP0011",
            "id": 20106,
            "categories": "filter_s5HidKit;samplePrepProtocol;s5hidSamplePrep",
            "name": "Ion Chef HID S530 V2"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Active Library Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activelibrarykitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activelibrarykitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 21,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activelibrarykitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "",
            "kitType": "LibraryKit",
            "description": "MuSeek Library Preparation Kit",
            "nucleotideType": "dna",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "",
            "chipTypes": "",
            "runMode": "",
            "parts": [],
            "flowCount": 0,
            "applicationType": "GENS",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activelibrarykitinfo/20025/",
            "uid": "LIB0012",
            "id": 20025,
            "categories": "filter_muSeek",
            "name": "MuSeek(tm) Library Preparation Kit"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Active Pgm Library Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activepgmlibrarykitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activepgmlibrarykitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 18,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activepgmlibrarykitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "",
            "kitType": "LibraryKit",
            "description": "MuSeek Library Preparation Kit",
            "nucleotideType": "dna",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "",
            "chipTypes": "",
            "runMode": "",
            "parts": [],
            "flowCount": 0,
            "applicationType": "GENS",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activepgmlibrarykitinfo/20025/",
            "uid": "LIB0012",
            "id": 20025,
            "categories": "filter_muSeek",
            "name": "MuSeek(tm) Library Preparation Kit"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Active Pgm Sequencing Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activepgmsequencingkitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activepgmsequencingkitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
defaultFlowOrder A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
name Unicode string data. Ex: “Hello World” n/a false false false true string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 4,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activepgmsequencingkitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "OT_IC",
            "kitType": "SequencingKit",
            "defaultFlowOrder": null,
            "name": "IonPGMInstallKit",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "pgm",
            "chipTypes": "",
            "runMode": "",
            "parts": [
                {
                    "barcode": "4480217",
                    "id": 20019,
                    "resource_uri": "/rundb/api/v1/kitpart/20019/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                },
                {
                    "barcode": "4480282",
                    "id": 20020,
                    "resource_uri": "/rundb/api/v1/kitpart/20020/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                },
                {
                    "barcode": "4480284",
                    "id": 20021,
                    "resource_uri": "/rundb/api/v1/kitpart/20021/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                }
            ],
            "flowCount": 100,
            "applicationType": "",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activepgmsequencingkitinfo/20020/",
            "uid": "SEQ0006",
            "id": 20020,
            "categories": "readLengthDerivableFromFlows;",
            "description": "Ion PGM Install Kit"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Active Proton Library Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activeprotonlibrarykitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activeprotonlibrarykitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 19,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activeprotonlibrarykitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "",
            "kitType": "LibraryKit",
            "description": "MuSeek Library Preparation Kit",
            "nucleotideType": "dna",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "",
            "chipTypes": "",
            "runMode": "",
            "parts": [],
            "flowCount": 0,
            "applicationType": "GENS",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activeprotonlibrarykitinfo/20025/",
            "uid": "LIB0012",
            "id": 20025,
            "categories": "filter_muSeek",
            "name": "MuSeek(tm) Library Preparation Kit"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Active Proton Sequencing Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activeprotonsequencingkitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activeprotonsequencingkitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
defaultFlowOrder A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
name Unicode string data. Ex: “Hello World” n/a false false false true string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 5,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activeprotonsequencingkitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "",
            "kitType": "SequencingKit",
            "defaultFlowOrder": null,
            "name": "ProtonI200Kit-v2",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "proton",
            "chipTypes": "900;P1.0.19;P1.0.20;P1.1.17;P1.1.541;P1.2.18;P2.0.1;P2.1.1;P2.3.1",
            "runMode": "",
            "parts": [
                {
                    "barcode": "4485149",
                    "id": 20094,
                    "resource_uri": "/rundb/api/v1/kitpart/20094/",
                    "kit": "/rundb/api/v1/kitinfo/20044/"
                },
                {
                    "barcode": "4485521",
                    "id": 20095,
                    "resource_uri": "/rundb/api/v1/kitpart/20095/",
                    "kit": "/rundb/api/v1/kitinfo/20044/"
                },
                {
                    "barcode": "4484082",
                    "id": 20096,
                    "resource_uri": "/rundb/api/v1/kitpart/20096/",
                    "kit": "/rundb/api/v1/kitinfo/20044/"
                },
                {
                    "barcode": "4482282",
                    "id": 20078,
                    "resource_uri": "/rundb/api/v1/kitpart/20078/",
                    "kit": "/rundb/api/v1/kitinfo/20044/"
                },
                {
                    "barcode": "4482284",
                    "id": 20079,
                    "resource_uri": "/rundb/api/v1/kitpart/20079/",
                    "kit": "/rundb/api/v1/kitinfo/20044/"
                }
            ],
            "flowCount": 500,
            "applicationType": "",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activeprotonsequencingkitinfo/20044/",
            "uid": "SEQ0012",
            "id": 20044,
            "categories": "readLengthDerivableFromFlows;",
            "description": "Ion PI Sequencing 200 Kit v2"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Active Sequencing Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/activesequencingkitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/activesequencingkitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
defaultFlowOrder A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
name Unicode string data. Ex: “Hello World” n/a false false false true string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 13,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/activesequencingkitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "OT_IC",
            "kitType": "SequencingKit",
            "defaultFlowOrder": null,
            "name": "IonPGMInstallKit",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "pgm",
            "chipTypes": "",
            "runMode": "",
            "parts": [
                {
                    "barcode": "4480217",
                    "id": 20019,
                    "resource_uri": "/rundb/api/v1/kitpart/20019/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                },
                {
                    "barcode": "4480282",
                    "id": 20020,
                    "resource_uri": "/rundb/api/v1/kitpart/20020/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                },
                {
                    "barcode": "4480284",
                    "id": 20021,
                    "resource_uri": "/rundb/api/v1/kitpart/20021/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                }
            ],
            "flowCount": 100,
            "applicationType": "",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/activesequencingkitinfo/20020/",
            "uid": "SEQ0006",
            "id": 20020,
            "categories": "readLengthDerivableFromFlows;",
            "description": "Ion PGM Install Kit"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Analysis Args Resource

Resource URL http://mytorrentserver/rundb/api/v1/analysisargs/
Schema URL http://mytorrentserver/rundb/api/v1/analysisargs/schema/

Resource Fields
field help text default nullable readonly blank unique type
ionstatsargs Unicode string data. Ex: “Hello World”   false false true false string
chipType Unicode string data. Ex: “Hello World”   false false false false string
creator A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
thumbnailionstatsargs Unicode string data. Ex: “Hello World”   false false true false string
thumbnailalignmentargs Unicode string data. Ex: “Hello World”   false false true false string
thumbnailanalysisargs Unicode string data. Ex: “Hello World”   false false true false string
samplePrepKitName Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
creationDate A date & time as a string. Ex: “2010-11-10T03:07:43” true true false false false datetime
sequenceKitName Unicode string data. Ex: “Hello World”   false false true false string
analysisargs Unicode string data. Ex: “Hello World”   false false true false string
thumbnailcalibrateargs Unicode string data. Ex: “Hello World”   false false true false string
applGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
chip_default Boolean data. Ex: True false false false true false boolean
lastModifiedDate A date & time as a string. Ex: “2010-11-10T03:07:43” true true false false false datetime
beadfindargs Unicode string data. Ex: “Hello World”   false false true false string
templateKitName Unicode string data. Ex: “Hello World”   false false true false string
prebasecallerargs Unicode string data. Ex: “Hello World”   false false true false string
description Unicode string data. Ex: “Hello World” n/a true false false true string
prethumbnailbasecallerargs Unicode string data. Ex: “Hello World”   false false true false string
applType A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
alignmentargs Unicode string data. Ex: “Hello World”   false false true false string
thumbnailbasecallerargs Unicode string data. Ex: “Hello World”   false false true false string
active Boolean data. Ex: True true false false true false boolean
isSystem Boolean data. Ex: True false false false true false boolean
thumbnailbeadfindargs Unicode string data. Ex: “Hello World”   false false true false string
calibrateargs Unicode string data. Ex: “Hello World”   false false true false string
libraryKitName Unicode string data. Ex: “Hello World”   false false true false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
basecallerargs Unicode string data. Ex: “Hello World”   false false true false string
lastModifiedUser A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 129,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/analysisargs/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "ionstatsargs": "ionstats alignment",
            "chipType": "314",
            "creator": null,
            "thumbnailionstatsargs": "",
            "thumbnailalignmentargs": "",
            "thumbnailanalysisargs": "",
            "samplePrepKitName": "",
            "id": 1,
            "creationDate": "2018-06-08T06:20:39.000036+00:00",
            "sequenceKitName": "",
            "analysisargs": "Analysis --args-json /opt/ion/config/args_314_analysis.json",
            "thumbnailcalibrateargs": "",
            "applGroup": null,
            "chip_default": true,
            "lastModifiedDate": "2018-06-08T06:20:39.000036+00:00",
            "beadfindargs": "justBeadFind --args-json /opt/ion/config/args_314_beadfind.json",
            "templateKitName": "",
            "prebasecallerargs": "BaseCaller --barcode-filter-minreads 20",
            "description": "Ion 314 chip v2 analysis arguments",
            "prethumbnailbasecallerargs": "",
            "applType": null,
            "alignmentargs": "tmap mapall ... stage1 map4",
            "thumbnailbasecallerargs": "",
            "active": true,
            "isSystem": true,
            "thumbnailbeadfindargs": "",
            "calibrateargs": "Calibration",
            "libraryKitName": "",
            "name": "ion_default_314",
            "basecallerargs": "BaseCaller --barcode-filter-minreads 20",
            "lastModifiedUser": null,
            "resource_uri": "/rundb/api/v1/analysisargs/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Analysis Metrics Resource

Resource URL http://mytorrentserver/rundb/api/v1/analysismetrics/
Schema URL http://mytorrentserver/rundb/api/v1/analysismetrics/schema/

Resource Fields
field help text default nullable readonly blank unique type
libLive Integer data. Ex: 2673 n/a false false false false integer
ignored Integer data. Ex: 2673 n/a false false false false integer
washout_ambiguous Integer data. Ex: 2673 n/a false false false false integer
tfLive Integer data. Ex: 2673 n/a false false false false integer
sysIE Floating point numeric data. Ex: 26.73 n/a false false false false float
bead Integer data. Ex: 2673 n/a false false false false integer
tfKp Integer data. Ex: 2673 n/a false false false false integer
washout_live Integer data. Ex: 2673 n/a false false false false integer
id Integer data. Ex: 2673   false false true true integer
libFinal Integer data. Ex: 2673 n/a false false false false integer
loading Floating point numeric data. Ex: 26.73 0 false false false false float
lib Integer data. Ex: 2673 n/a false false false false integer
keypass_all_beads Integer data. Ex: 2673 n/a false false false false integer
dud Integer data. Ex: 2673 n/a false false false false integer
sysCF Floating point numeric data. Ex: 26.73 n/a false false false false float
pinned Integer data. Ex: 2673 n/a false false false false integer
live Integer data. Ex: 2673 n/a false false false false integer
excluded Integer data. Ex: 2673 n/a false false false false integer
tf Integer data. Ex: 2673 n/a false false false false integer
empty Integer data. Ex: 2673 n/a false false false false integer
tfFinal Integer data. Ex: 2673 n/a false false false false integer
amb Integer data. Ex: 2673 n/a false false false false integer
lib_pass_basecaller Integer data. Ex: 2673 n/a false false false false integer
lib_pass_cafie Integer data. Ex: 2673 n/a false false false false integer
washout_dud Integer data. Ex: 2673 n/a false false false false integer
libMix Integer data. Ex: 2673 n/a false false false false integer
report A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
libKp Integer data. Ex: 2673 n/a false false false false integer
adjusted_addressable Integer data. Ex: 2673 0 false false false false integer
sysDR Floating point numeric data. Ex: 26.73 n/a false false false false float
total Integer data. Ex: 2673 0 false false false false integer
washout_test_fragment Integer data. Ex: 2673 n/a false false false false integer
washout_library Integer data. Ex: 2673 n/a false false false false integer
washout Integer data. Ex: 2673 n/a false false false false integer
tfMix Integer data. Ex: 2673 n/a false false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 6,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/analysismetrics/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "libLive": 0,
            "ignored": 1042801,
            "washout_ambiguous": 0,
            "tfLive": 0,
            "sysIE": 0.465626595541835,
            "bead": 140400602,
            "tfKp": 0,
            "washout_live": 0,
            "id": 1,
            "libFinal": 93974105,
            "loading": 94.7655552064634,
            "lib": 139085639,
            "keypass_all_beads": 0,
            "dud": 60690,
            "sysCF": 0.603865925222635,
            "pinned": 2329,
            "live": 140339912,
            "excluded": 16543404,
            "tf": 1254273,
            "empty": 6710000,
            "tfFinal": 1198552,
            "amb": 0,
            "lib_pass_basecaller": 0,
            "lib_pass_cafie": 0,
            "washout_dud": 0,
            "libMix": 0,
            "report": "/rundb/api/v1/results/3/",
            "libKp": 0,
            "adjusted_addressable": 148155732,
            "sysDR": 0.168037705589086,
            "total": 164699136,
            "washout_test_fragment": 0,
            "washout_library": 0,
            "washout": 0,
            "tfMix": 0,
            "resource_uri": "/rundb/api/v1/analysismetrics/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Application Group Resource

Resource URL http://mytorrentserver/rundb/api/v1/applicationgroup/
Schema URL http://mytorrentserver/rundb/api/v1/applicationgroup/schema/

Resource Fields
field help text default nullable readonly blank unique type
name Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World” n/a true false false false string
applications Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false false false related
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
isActive Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 12,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/applicationgroup/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "name": "DNA",
            "description": "DNA",
            "applications": [
                {
                    "applicationGroups": [
                        "/rundb/api/v1/applicationgroup/1/",
                        "/rundb/api/v1/applicationgroup/3/",
                        "/rundb/api/v1/applicationgroup/4/"
                    ],
                    "description": "Generic Sequencing",
                    "nucleotideType": "dna",
                    "barcode": "",
                    "meta": {},
                    "alternate_name": "Other",
                    "runType": "GENS",
                    "id": 1,
                    "isActive": true,
                    "resource_uri": "/rundb/api/v1/runtype/1/"
                },
                {
                    "applicationGroups": [
                        "/rundb/api/v1/applicationgroup/1/",
                        "/rundb/api/v1/applicationgroup/6/",
                        "/rundb/api/v1/applicationgroup/8/",
                        "/rundb/api/v1/applicationgroup/10/"
                    ],
                    "description": "AmpliSeq DNA",
                    "nucleotideType": "dna",
                    "barcode": "",
                    "meta": {},
                    "alternate_name": "AmpliSeq DNA",
                    "runType": "AMPS",
                    "id": 2,
                    "isActive": true,
                    "resource_uri": "/rundb/api/v1/runtype/2/"
                },
                {
                    "applicationGroups": [
                        "/rundb/api/v1/applicationgroup/1/"
                    ],
                    "description": "TargetSeq",
                    "nucleotideType": "dna",
                    "barcode": "",
                    "meta": {},
                    "alternate_name": "TargetSeq",
                    "runType": "TARS",
                    "id": 3,
                    "isActive": true,
                    "resource_uri": "/rundb/api/v1/runtype/3/"
                },
                {
                    "applicationGroups": [
                        "/rundb/api/v1/applicationgroup/1/",
                        "/rundb/api/v1/applicationgroup/4/"
                    ],
                    "description": "Whole Genome",
                    "nucleotideType": "dna",
                    "barcode": "",
                    "meta": {},
                    "alternate_name": "Whole Genome",
                    "runType": "WGNM",
                    "id": 4,
                    "isActive": true,
                    "resource_uri": "/rundb/api/v1/runtype/4/"
                },
                {
                    "applicationGroups": [
                        "/rundb/api/v1/applicationgroup/1/"
                    ],
                    "description": "AmpliSeq Exome",
                    "nucleotideType": "dna",
                    "barcode": "",
                    "meta": {},
                    "alternate_name": "AmpliSeq Exome",
                    "runType": "AMPS_EXOME",
                    "id": 7,
                    "isActive": true,
                    "resource_uri": "/rundb/api/v1/runtype/7/"
                },
                {
                    "applicationGroups": [
                        "/rundb/api/v1/applicationgroup/1/"
                    ],
                    "description": "AmpliSeq HD - DNA",
                    "nucleotideType": "dna",
                    "barcode": "",
                    "meta": {},
                    "alternate_name": "AmpliSeq HD - DNA",
                    "runType": "AMPS_HD_DNA",
                    "id": 12,
                    "isActive": true,
                    "resource_uri": "/rundb/api/v1/runtype/12/"
                }
            ],
            "uid": "APPLGROUP_0001",
            "id": 1,
            "isActive": true,
            "resource_uri": "/rundb/api/v1/applicationgroup/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Appl Product Resource

Resource URL http://mytorrentserver/rundb/api/v1/applproduct/
Schema URL http://mytorrentserver/rundb/api/v1/applproduct/schema/

Resource Fields
field help text default nullable readonly blank unique type
isDualNucleotideTypeBySampleSupported Boolean data. Ex: True false false false true false boolean
defaultHotSpotRegionBedFileName Unicode string data. Ex: “Hello World” n/a true false false false string
isTargetRegionBEDFileSupported Boolean data. Ex: True true false false true false boolean
isSamplePrepKitSupported Boolean data. Ex: True true false false true false boolean
defaultSeqKit A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
isControlSeqTypeBySampleSupported Boolean data. Ex: True false false false true false boolean
defaultBarcodeKitName Unicode string data. Ex: “Hello World” n/a true false false false string
isHotSpotBEDFileBySampleSupported Boolean data. Ex: True false false false true false boolean
id Integer data. Ex: 2673   false false true true integer
isTargetRegionBEDFileBySampleSupported Boolean data. Ex: True false false false true false boolean
isReferenceSelectionSupported Boolean data. Ex: True true false false true false boolean
productCode Unicode string data. Ex: “Hello World” any false false false true string
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
dualBarcodingRule Unicode string data. Ex: “Hello World”   false false true false string
defaultChipType Unicode string data. Ex: “Hello World” n/a true false false false string
appl A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
categories Unicode string data. Ex: “Hello World”   true false false false string
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
isDefault Boolean data. Ex: True false false false true false boolean
isTargetTechniqueSelectionSupported Boolean data. Ex: True true false false true false boolean
description Unicode string data. Ex: “Hello World”   false false true false string
isHotspotRegionBEDFileSuppported Boolean data. Ex: True true false false true false boolean
isVisible Boolean data. Ex: True false false false true false boolean
productName Unicode string data. Ex: “Hello World” n/a false false false false string
isBarcodeKitSelectionRequired Boolean data. Ex: True false false false true false boolean
isDefaultBarcoded Boolean data. Ex: True false false false true false boolean
isTargetRegionBEDFileSelectionRequiredForRefSelection Boolean data. Ex: True false false false true false boolean
isDualBarcodingBySampleSupported Boolean data. Ex: True false false false true false boolean
defaultTargetRegionBedFileName Unicode string data. Ex: “Hello World” n/a true false false false string
isActive Boolean data. Ex: True true false false true false boolean
isReferenceBySampleSupported Boolean data. Ex: True false false false true false boolean
defaultFlowCount Integer data. Ex: 2673 0 false false false false integer
defaultLibKit A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
barcodeKitSelectableType Unicode string data. Ex: “Hello World”   false false true false string
isDefaultForInstrumentType Boolean data. Ex: True false false false true false boolean
defaultGenomeRefName Unicode string data. Ex: “Hello World” n/a true false false false string
defaultSamplePrepKit A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
defaultControlSeqKit A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
defaultIonChefPrepKit A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
defaultIonChefSequencingKit A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
defaultTemplateKit A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 59,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/applproduct/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isDualNucleotideTypeBySampleSupported": false,
            "defaultHotSpotRegionBedFileName": "",
            "isTargetRegionBEDFileSupported": true,
            "isSamplePrepKitSupported": true,
            "defaultSeqKit": {
                "isActive": true,
                "samplePrep_instrumentType": "OT_IC_IA",
                "kitType": "SequencingKit",
                "defaultFlowOrder": null,
                "name": "IonPGMHiQView",
                "nucleotideType": "",
                "defaultCartridgeUsageCount": null,
                "instrumentType": "pgm",
                "chipTypes": "",
                "runMode": "",
                "parts": [
                    {
                        "barcode": "A30044",
                        "id": 20203,
                        "resource_uri": "/rundb/api/v1/kitpart/20203/",
                        "kit": "/rundb/api/v1/kitinfo/20090/"
                    },
                    {
                        "barcode": "A30043",
                        "id": 20204,
                        "resource_uri": "/rundb/api/v1/kitpart/20204/",
                        "kit": "/rundb/api/v1/kitinfo/20090/"
                    },
                    {
                        "barcode": "A30275",
                        "id": 20205,
                        "resource_uri": "/rundb/api/v1/kitpart/20205/",
                        "kit": "/rundb/api/v1/kitinfo/20090/"
                    },
                    {
                        "barcode": "A25590",
                        "id": 20206,
                        "resource_uri": "/rundb/api/v1/kitpart/20206/",
                        "kit": "/rundb/api/v1/kitinfo/20090/"
                    }
                ],
                "flowCount": 500,
                "applicationType": "",
                "cartridgeExpirationDayLimit": null,
                "libraryReadLength": 0,
                "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
                "resource_uri": "/rundb/api/v1/kitinfo/20090/",
                "uid": "SEQ0024",
                "id": 20090,
                "categories": "flowOverridable;readLengthDerivableFromFlows;",
                "description": "Ion PGM Hi-Q View Sequencing Kit"
            },
            "isControlSeqTypeBySampleSupported": false,
            "defaultBarcodeKitName": null,
            "isHotSpotBEDFileBySampleSupported": true,
            "id": 20001,
            "isTargetRegionBEDFileBySampleSupported": true,
            "isReferenceSelectionSupported": true,
            "productCode": "AMPS_0",
            "applicationGroup": {
                "name": "DNA",
                "description": "DNA",
                "applications": [
                    {
                        "applicationGroups": [
                            "/rundb/api/v1/applicationgroup/1/",
                            "/rundb/api/v1/applicationgroup/3/",
                            "/rundb/api/v1/applicationgroup/4/"
                        ],
                        "description": "Generic Sequencing",
                        "nucleotideType": "dna",
                        "barcode": "",
                        "meta": {},
                        "alternate_name": "Other",
                        "runType": "GENS",
                        "id": 1,
                        "isActive": true,
                        "resource_uri": "/rundb/api/v1/runtype/1/"
                    },
                    {
                        "applicationGroups": [
                            "/rundb/api/v1/applicationgroup/1/",
                            "/rundb/api/v1/applicationgroup/6/",
                            "/rundb/api/v1/applicationgroup/8/",
                            "/rundb/api/v1/applicationgroup/10/"
                        ],
                        "description": "AmpliSeq DNA",
                        "nucleotideType": "dna",
                        "barcode": "",
                        "meta": {},
                        "alternate_name": "AmpliSeq DNA",
                        "runType": "AMPS",
                        "id": 2,
                        "isActive": true,
                        "resource_uri": "/rundb/api/v1/runtype/2/"
                    },
                    {
                        "applicationGroups": [
                            "/rundb/api/v1/applicationgroup/1/"
                        ],
                        "description": "TargetSeq",
                        "nucleotideType": "dna",
                        "barcode": "",
                        "meta": {},
                        "alternate_name": "TargetSeq",
                        "runType": "TARS",
                        "id": 3,
                        "isActive": true,
                        "resource_uri": "/rundb/api/v1/runtype/3/"
                    },
                    {
                        "applicationGroups": [
                            "/rundb/api/v1/applicationgroup/1/",
                            "/rundb/api/v1/applicationgroup/4/"
                        ],
                        "description": "Whole Genome",
                        "nucleotideType": "dna",
                        "barcode": "",
                        "meta": {},
                        "alternate_name": "Whole Genome",
                        "runType": "WGNM",
                        "id": 4,
                        "isActive": true,
                        "resource_uri": "/rundb/api/v1/runtype/4/"
                    },
                    {
                        "applicationGroups": [
                            "/rundb/api/v1/applicationgroup/1/"
                        ],
                        "description": "AmpliSeq Exome",
                        "nucleotideType": "dna",
                        "barcode": "",
                        "meta": {},
                        "alternate_name": "AmpliSeq Exome",
                        "runType": "AMPS_EXOME",
                        "id": 7,
                        "isActive": true,
                        "resource_uri": "/rundb/api/v1/runtype/7/"
                    },
                    {
                        "applicationGroups": [
                            "/rundb/api/v1/applicationgroup/1/"
                        ],
                        "description": "AmpliSeq HD - DNA",
                        "nucleotideType": "dna",
                        "barcode": "",
                        "meta": {},
                        "alternate_name": "AmpliSeq HD - DNA",
                        "runType": "AMPS_HD_DNA",
                        "id": 12,
                        "isActive": true,
                        "resource_uri": "/rundb/api/v1/runtype/12/"
                    }
                ],
                "uid": "APPLGROUP_0001",
                "id": 1,
                "isActive": true,
                "resource_uri": "/rundb/api/v1/applicationgroup/1/"
            },
            "dualBarcodingRule": "",
            "defaultChipType": "318",
            "appl": {
                "applicationGroups": [
                    "/rundb/api/v1/applicationgroup/1/",
                    "/rundb/api/v1/applicationgroup/6/",
                    "/rundb/api/v1/applicationgroup/8/",
                    "/rundb/api/v1/applicationgroup/10/"
                ],
                "description": "AmpliSeq DNA",
                "nucleotideType": "dna",
                "barcode": "",
                "meta": {},
                "alternate_name": "AmpliSeq DNA",
                "runType": "AMPS",
                "id": 2,
                "isActive": true,
                "resource_uri": "/rundb/api/v1/runtype/2/"
            },
            "categories": "",
            "instrumentType": "pgm",
            "isDefault": true,
            "isTargetTechniqueSelectionSupported": true,
            "description": "",
            "isHotspotRegionBEDFileSuppported": true,
            "isVisible": true,
            "productName": "AMPS_default",
            "isBarcodeKitSelectionRequired": false,
            "isDefaultBarcoded": false,
            "isTargetRegionBEDFileSelectionRequiredForRefSelection": true,
            "isDualBarcodingBySampleSupported": false,
            "defaultTargetRegionBedFileName": "",
            "isActive": true,
            "isReferenceBySampleSupported": true,
            "defaultFlowCount": 500,
            "defaultLibKit": {
                "isActive": true,
                "samplePrep_instrumentType": "",
                "kitType": "LibraryKit",
                "defaultFlowOrder": null,
                "name": "Ion AmpliSeq 2.0 Library Kit",
                "nucleotideType": "dna",
                "defaultCartridgeUsageCount": null,
                "instrumentType": "",
                "chipTypes": "",
                "runMode": "",
                "parts": [
                    {
                        "barcode": "4475345",
                        "id": 20034,
                        "resource_uri": "/rundb/api/v1/kitpart/20034/",
                        "kit": "/rundb/api/v1/kitinfo/20012/"
                    }
                ],
                "flowCount": 0,
                "applicationType": "AMPS_ANY",
                "cartridgeExpirationDayLimit": null,
                "libraryReadLength": 0,
                "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
                "resource_uri": "/rundb/api/v1/kitinfo/20012/",
                "uid": "LIB0008",
                "id": 20012,
                "categories": "",
                "description": "Ion AmpliSeq 2.0 Library Kit"
            },
            "barcodeKitSelectableType": "all",
            "isDefaultForInstrumentType": true,
            "defaultGenomeRefName": "hg19",
            "defaultSamplePrepKit": null,
            "defaultControlSeqKit": null,
            "defaultIonChefPrepKit": "/rundb/api/v1/kitinfo/20093/",
            "resource_uri": "/rundb/api/v1/applproduct/20001/",
            "defaultIonChefSequencingKit": "/rundb/api/v1/kitinfo/20090/",
            "defaultTemplateKit": "/rundb/api/v1/kitinfo/20091/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Available Ion Chef Planned Experiment Resource

Resource URL http://mytorrentserver/rundb/api/v1/availableionchefplannedexperiment/
Schema URL http://mytorrentserver/rundb/api/v1/availableionchefplannedexperiment/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
chipType Unicode string data. Ex: “Hello World” n/a true true true false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
username Unicode string data. Ex: “Hello World” n/a true false false false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/availableionchefplannedexperiment/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA",
            "isReverseRun": false,
            "chipType": "540",
            "planShortID": "SP1XE",
            "username": "ionadmin",
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "planStatus": "pending",
            "samplePrepProtocolName": "",
            "experiment": "/rundb/api/v1/experiment/136/",
            "sampleTubeLabel": "",
            "date": "2018-04-13T22:17:13.000108+00:00",
            "id": 143,
            "templatingKitName": "Ion Chef S540 V1"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Available Ion Chef Planned Experiment Summary Resource

Resource URL http://mytorrentserver/rundb/api/v1/availableionchefplannedexperimentsummary/
Schema URL http://mytorrentserver/rundb/api/v1/availableionchefplannedexperimentsummary/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
username Unicode string data. Ex: “Hello World” n/a true false false false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/availableionchefplannedexperimentsummary/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA",
            "isReverseRun": false,
            "planShortID": "SP1XE",
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "planStatus": "pending",
            "username": "ionadmin",
            "experiment": "/rundb/api/v1/experiment/136/",
            "sampleTubeLabel": "",
            "date": "2018-04-13T22:17:13.000108+00:00",
            "id": 143,
            "templatingKitName": "Ion Chef S540 V1"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Available Onetouch Planned Experiment Resource

Resource URL http://mytorrentserver/rundb/api/v1/availableonetouchplannedexperiment/
Schema URL http://mytorrentserver/rundb/api/v1/availableonetouchplannedexperiment/schema/

Resource Fields
field help text default nullable readonly blank unique type
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
autoAnalyze Boolean data. Ex: True n/a false false false false boolean
endBarcodeKitName Unicode string data. Ex: “Hello World”   true false true false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
mixedTypeRNA_hotSpotRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_targetRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
platform Unicode string data. Ex: “Hello World” n/a true false true false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
notes Unicode string data. Ex: “Hello World”   true false true false string
sequencekitname Unicode string data. Ex: “Hello World”   true false true false string
base_recalibration_mode Unicode string data. Ex: “Hello World”   true false true false string
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
cycles Integer data. Ex: 2673 n/a true false false false integer
isReverseRun Boolean data. Ex: True false false false true false boolean
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chipType Unicode string data. Ex: “Hello World”   false false false false string
library Unicode string data. Ex: “Hello World”   true false true false string
reverselibrarykey Unicode string data. Ex: “Hello World”   false true false false string
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
barcodeId Unicode string data. Ex: “Hello World”   true false true false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
realign Boolean data. Ex: True n/a false false false false boolean
sampleGroupingName Unicode string data. Ex: “Hello World” n/a true true true false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
bedfile Unicode string data. Ex: “Hello World”   false false true false string
applicationCategoryDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
isReusable Boolean data. Ex: True false false false true false boolean
isDuplicateReads Boolean data. Ex: True n/a false false false false boolean
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
librarykitname Unicode string data. Ex: “Hello World”   true false true false string
sseBedFile Unicode string data. Ex: “Hello World”   false false true false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
earlyDatFileDeletion Boolean data. Ex: True false false true false false boolean
parentPlan Unicode string data. Ex: “Hello World” None false false true false string
origin Unicode string data. Ex: “Hello World”   true false false false string
forward3primeadapter Unicode string data. Ex: “Hello World”   true false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroupDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
qcValues Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
planStatus Unicode string data. Ex: “Hello World”   false false true false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
username Unicode string data. Ex: “Hello World” n/a true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
sampleDisplayedName Unicode string data. Ex: “Hello World”   true false true false string
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
tfKey Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_reference Unicode string data. Ex: “Hello World”   true false true false string
childPlans A list of data. Ex: [‘abc’, 26.73, 8] [] false false false false list
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
project Unicode string data. Ex: “Hello World” n/a false true true false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
chefInfo A dictionary of data. Ex: {‘price’: 26.73, ‘name’: ‘Daniel’} {} false false false false dict
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
sample Unicode string data. Ex: “Hello World”   true false true false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
barcodedSamples Unicode string data. Ex: “Hello World”   true false true false string
regionfile Unicode string data. Ex: “Hello World”   false false true false string
selectedPlugins Unicode string data. Ex: “Hello World”   true false true false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
libraryKey Unicode string data. Ex: “Hello World”   false false true false string
flows Integer data. Ex: 2673 0 false false false false integer
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
variantfrequency Unicode string data. Ex: “Hello World”   false true false false string
sampleSetDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
flowsInOrder Unicode string data. Ex: “Hello World”   true false true false string
libraryPrepType Unicode string data. Ex: “Hello World”   true true true false string
sampleGrouping A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
chipBarcode Unicode string data. Ex: “Hello World”   false false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
libraryPrepTypeDisplayedName Unicode string data. Ex: “Hello World”   true true true false string
reverse3primeadapter Unicode string data. Ex: “Hello World”   false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 1,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": [
        {
            "planDisplayedName": "Ion ReproSeq Aneuploidy - Ion PGM System",
            "autoAnalyze": true,
            "endBarcodeKitName": "",
            "templatingKitBarcode": null,
            "preAnalysis": true,
            "thumbnailanalysisargs": "",
            "applicationGroup": "/rundb/api/v1/applicationgroup/1/",
            "mixedTypeRNA_hotSpotRegionBedFile": "",
            "mixedTypeRNA_targetRegionBedFile": "",
            "platform": "",
            "categories": "repro",
            "planPGM": null,
            "prebasecallerargs": "BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 20 --extra-trim-left 30",
            "alignmentargs": "tmap mapall ... stage1 map4",
            "thumbnailbasecallerargs": "",
            "libkit": null,
            "projects": [],
            "notes": "",
            "sequencekitname": "IonPGMHiQ",
            "base_recalibration_mode": "standard_recal",
            "storageHost": null,
            "expName": "",
            "thumbnailionstatsargs": "",
            "cycles": null,
            "isReverseRun": false,
            "storage_options": "A",
            "thumbnailalignmentargs": "",
            "chipType": "318",
            "library": "hg19",
            "runMode": "single",
            "sampleTubeLabel": "",
            "seqKitBarcode": null,
            "barcodeId": "Ion SingleSeq Barcode set 1-24",
            "isPlanGroup": false,
            "realign": false,
            "sampleGroupingName": "Self",
            "experiment": "/rundb/api/v1/experiment/123/",
            "bedfile": "",
            "applicationCategoryDisplayedName": "Reproductive",
            "isReusable": false,
            "isDuplicateReads": false,
            "sampleSets": [],
            "thumbnailbeadfindargs": "",
            "librarykitname": "IonPicoPlex",
            "sseBedFile": "",
            "adapter": null,
            "basecallerargs": "BaseCaller  --barcode-filter 0.01 --barcode-filter-minreads 20 --extra-trim-left 30",
            "earlyDatFileDeletion": false,
            "parentPlan": null,
            "origin": "gui|5.8.0",
            "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGAAAGCGG",
            "planStatus": "planned",
            "isCustom_kitSettings": false,
            "samplePrepKitName": null,
            "applicationGroupDisplayedName": "DNA",
            "metaData": {
                "fromTemplate": "Ion_ReproSeq_Aneuploidy_-_Ion_PGM_System",
                "fromTemplateSource": "ION"
            },
            "isFavorite": false,
            "qcValues": [
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/131/",
                    "id": 370,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Bead Loading (%)",
                        "id": 1,
                        "resource_uri": "/rundb/api/v1/qctype/1/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/370/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/131/",
                    "id": 371,
                    "qcType": {
                        "description": "",
                        "minThreshold": 1,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Key Signal (1-100)",
                        "id": 2,
                        "resource_uri": "/rundb/api/v1/qctype/2/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/371/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/131/",
                    "id": 372,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Usable Sequence (%)",
                        "id": 3,
                        "resource_uri": "/rundb/api/v1/qctype/3/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/372/"
                }
            ],
            "analysisargs": "Analysis --args-json /opt/ion/config/args_318_analysis.json --mixed-first-flow 51 --mixed-last-flow 111",
            "thumbnailcalibrateargs": "",
            "templatingKitName": "Ion PGM Template IA Tech Access Kit",
            "runType": "WGNM",
            "username": "ionadmin",
            "planShortID": "6TGIO",
            "sampleDisplayedName": "",
            "prethumbnailbasecallerargs": "",
            "controlSequencekitname": null,
            "tfKey": "ATCG",
            "mixedTypeRNA_reference": "",
            "childPlans": [],
            "pairedEndLibraryAdapterName": "",
            "reverselibrarykey": "",
            "irworkflow": "",
            "planExecuted": false,
            "project": "",
            "usePostBeadfind": true,
            "libraryReadLength": 0,
            "runname": null,
            "chefInfo": {},
            "planGUID": "d1ed9718-b6f4-4dfd-8de5-bbd150092997",
            "ionstatsargs": "ionstats alignment",
            "samplePrepProtocol": "",
            "sample": "",
            "planExecutedDate": null,
            "reverse_primer": null,
            "id": 131,
            "barcodedSamples": {
                "Sample 6": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_006": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_006"
                    ]
                },
                "Sample 7": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_007": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_007"
                    ]
                },
                "Sample 4": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_004": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_004"
                    ]
                },
                "Sample 5": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_005": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_005"
                    ]
                },
                "Sample 2": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_002": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_002"
                    ]
                },
                "Sample 3": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_003": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_003"
                    ]
                },
                "Sample 1": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_001": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_001"
                    ]
                }
            },
            "custom_args": false,
            "regionfile": "",
            "selectedPlugins": {
                "FilterDuplicates": {
                    "userInput": "",
                    "version": "5.8.0.0",
                    "features": [],
                    "name": "FilterDuplicates",
                    "id": 34
                }
            },
            "beadfindargs": "justBeadFind --args-json /opt/ion/config/args_318_beadfind.json",
            "isSystemDefault": false,
            "autoName": null,
            "libraryKey": "TCAG",
            "flows": 250,
            "date": "2018-02-26T17:28:33.000588+00:00",
            "isSystem": false,
            "variantfrequency": "",
            "planName": "Ion_ReproSeq_Aneuploidy_-_Ion_PGM_System",
            "calibrateargs": "Calibration",
            "flowsInOrder": "",
            "libraryPrepType": "",
            "sampleGrouping": "/rundb/api/v1/samplegrouptype_cv/2/",
            "chipBarcode": "",
            "sampleSetDisplayedName": "",
            "usePreBeadfind": true,
            "resource_uri": "/rundb/api/v1/availableonetouchplannedexperiment/131/",
            "libraryPrepTypeDisplayedName": "",
            "reverse3primeadapter": ""
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Available Onetouch Planned Experiment Summary Resource

Resource URL http://mytorrentserver/rundb/api/v1/availableonetouchplannedexperimentsummary/
Schema URL http://mytorrentserver/rundb/api/v1/availableonetouchplannedexperimentsummary/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
username Unicode string data. Ex: “Hello World” n/a true false false false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 1,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": [
        {
            "origin": "gui|5.8.0",
            "isReverseRun": false,
            "planDisplayedName": "Ion ReproSeq Aneuploidy - Ion PGM System",
            "storage_options": "A",
            "preAnalysis": true,
            "planShortID": "6TGIO",
            "planStatus": "planned",
            "runMode": "single",
            "isCustom_kitSettings": false,
            "sampleTubeLabel": "",
            "planExecutedDate": null,
            "samplePrepKitName": null,
            "reverse_primer": null,
            "seqKitBarcode": null,
            "id": 131,
            "metaData": {
                "fromTemplate": "Ion_ReproSeq_Aneuploidy_-_Ion_PGM_System",
                "fromTemplateSource": "ION"
            },
            "isFavorite": false,
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "templatingKitName": "Ion PGM Template IA Tech Access Kit",
            "runType": "WGNM",
            "templatingKitBarcode": null,
            "planPGM": null,
            "isSystemDefault": false,
            "autoName": null,
            "isReusable": false,
            "controlSequencekitname": null,
            "date": "2018-02-26T17:28:33.000588+00:00",
            "isSystem": false,
            "libkit": null,
            "categories": "repro",
            "planName": "Ion_ReproSeq_Aneuploidy_-_Ion_PGM_System",
            "pairedEndLibraryAdapterName": "",
            "adapter": null,
            "irworkflow": "",
            "planExecuted": false,
            "username": "ionadmin",
            "usePostBeadfind": true,
            "storageHost": null,
            "expName": "",
            "libraryReadLength": 0,
            "runname": null,
            "usePreBeadfind": true,
            "planGUID": "d1ed9718-b6f4-4dfd-8de5-bbd150092997",
            "cycles": null,
            "resource_uri": "/rundb/api/v1/availableonetouchplannedexperimentsummary/131/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Available Planned Experiment Summary Resource

Resource URL http://mytorrentserver/rundb/api/v1/availableplannedexperimentsummary/
Schema URL http://mytorrentserver/rundb/api/v1/availableplannedexperimentsummary/schema/

Resource Fields
field help text default nullable readonly blank unique type
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
autoAnalyze Boolean data. Ex: True n/a false false false false boolean
endBarcodeKitName Unicode string data. Ex: “Hello World”   true false true false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
mixedTypeRNA_hotSpotRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_targetRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
platform Unicode string data. Ex: “Hello World” n/a true false true false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
notes Unicode string data. Ex: “Hello World”   true false true false string
sequencekitname Unicode string data. Ex: “Hello World”   true false true false string
base_recalibration_mode Unicode string data. Ex: “Hello World”   true false true false string
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
cycles Integer data. Ex: 2673 n/a true false false false integer
isReverseRun Boolean data. Ex: True false false false true false boolean
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chipType Unicode string data. Ex: “Hello World”   false false false false string
library Unicode string data. Ex: “Hello World”   true false true false string
reverselibrarykey Unicode string data. Ex: “Hello World”   false true false false string
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
barcodeId Unicode string data. Ex: “Hello World”   true false true false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
realign Boolean data. Ex: True n/a false false false false boolean
sampleGroupingName Unicode string data. Ex: “Hello World” n/a true true true false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
bedfile Unicode string data. Ex: “Hello World”   false false true false string
applicationCategoryDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
isReusable Boolean data. Ex: True false false false true false boolean
isDuplicateReads Boolean data. Ex: True n/a false false false false boolean
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
librarykitname Unicode string data. Ex: “Hello World”   true false true false string
sseBedFile Unicode string data. Ex: “Hello World”   false false true false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
earlyDatFileDeletion Boolean data. Ex: True false false true false false boolean
parentPlan Unicode string data. Ex: “Hello World” None false false true false string
origin Unicode string data. Ex: “Hello World”   true false false false string
forward3primeadapter Unicode string data. Ex: “Hello World”   true false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroupDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
qcValues Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
planStatus Unicode string data. Ex: “Hello World”   false false true false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
username Unicode string data. Ex: “Hello World” n/a true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
sampleDisplayedName Unicode string data. Ex: “Hello World”   true false true false string
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
tfKey Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_reference Unicode string data. Ex: “Hello World”   true false true false string
childPlans A list of data. Ex: [‘abc’, 26.73, 8] [] false false false false list
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
project Unicode string data. Ex: “Hello World” n/a false true true false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
chefInfo A dictionary of data. Ex: {‘price’: 26.73, ‘name’: ‘Daniel’} {} false false false false dict
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
sample Unicode string data. Ex: “Hello World”   true false true false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
barcodedSamples Unicode string data. Ex: “Hello World”   true false true false string
regionfile Unicode string data. Ex: “Hello World”   false false true false string
selectedPlugins Unicode string data. Ex: “Hello World”   true false true false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
libraryKey Unicode string data. Ex: “Hello World”   false false true false string
flows Integer data. Ex: 2673 0 false false false false integer
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
variantfrequency Unicode string data. Ex: “Hello World”   false true false false string
sampleSetDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
flowsInOrder Unicode string data. Ex: “Hello World”   true false true false string
libraryPrepType Unicode string data. Ex: “Hello World”   true true true false string
sampleGrouping A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
chipBarcode Unicode string data. Ex: “Hello World”   false false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
libraryPrepTypeDisplayedName Unicode string data. Ex: “Hello World”   true true true false string
reverse3primeadapter Unicode string data. Ex: “Hello World”   false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 1,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": [
        {
            "planDisplayedName": "Ion ReproSeq Aneuploidy - Ion PGM System",
            "autoAnalyze": true,
            "endBarcodeKitName": "",
            "templatingKitBarcode": null,
            "preAnalysis": true,
            "thumbnailanalysisargs": "",
            "applicationGroup": "/rundb/api/v1/applicationgroup/1/",
            "mixedTypeRNA_hotSpotRegionBedFile": "",
            "mixedTypeRNA_targetRegionBedFile": "",
            "platform": "",
            "categories": "repro",
            "planPGM": null,
            "prebasecallerargs": "BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 20 --extra-trim-left 30",
            "alignmentargs": "tmap mapall ... stage1 map4",
            "thumbnailbasecallerargs": "",
            "libkit": null,
            "projects": [],
            "notes": "",
            "sequencekitname": "IonPGMHiQ",
            "base_recalibration_mode": "standard_recal",
            "storageHost": null,
            "expName": "",
            "thumbnailionstatsargs": "",
            "cycles": null,
            "isReverseRun": false,
            "storage_options": "A",
            "thumbnailalignmentargs": "",
            "chipType": "318",
            "library": "hg19",
            "runMode": "single",
            "sampleTubeLabel": "",
            "seqKitBarcode": null,
            "barcodeId": "Ion SingleSeq Barcode set 1-24",
            "isPlanGroup": false,
            "realign": false,
            "sampleGroupingName": "Self",
            "experiment": "/rundb/api/v1/experiment/123/",
            "bedfile": "",
            "applicationCategoryDisplayedName": "Reproductive",
            "isReusable": false,
            "isDuplicateReads": false,
            "sampleSets": [],
            "thumbnailbeadfindargs": "",
            "librarykitname": "IonPicoPlex",
            "sseBedFile": "",
            "adapter": null,
            "basecallerargs": "BaseCaller  --barcode-filter 0.01 --barcode-filter-minreads 20 --extra-trim-left 30",
            "earlyDatFileDeletion": false,
            "parentPlan": null,
            "origin": "gui|5.8.0",
            "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGAAAGCGG",
            "planStatus": "planned",
            "isCustom_kitSettings": false,
            "samplePrepKitName": null,
            "applicationGroupDisplayedName": "DNA",
            "metaData": {
                "fromTemplate": "Ion_ReproSeq_Aneuploidy_-_Ion_PGM_System",
                "fromTemplateSource": "ION"
            },
            "isFavorite": false,
            "qcValues": [
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/131/",
                    "id": 370,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Bead Loading (%)",
                        "id": 1,
                        "resource_uri": "/rundb/api/v1/qctype/1/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/370/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/131/",
                    "id": 371,
                    "qcType": {
                        "description": "",
                        "minThreshold": 1,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Key Signal (1-100)",
                        "id": 2,
                        "resource_uri": "/rundb/api/v1/qctype/2/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/371/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/131/",
                    "id": 372,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Usable Sequence (%)",
                        "id": 3,
                        "resource_uri": "/rundb/api/v1/qctype/3/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/372/"
                }
            ],
            "analysisargs": "Analysis --args-json /opt/ion/config/args_318_analysis.json --mixed-first-flow 51 --mixed-last-flow 111",
            "thumbnailcalibrateargs": "",
            "templatingKitName": "Ion PGM Template IA Tech Access Kit",
            "runType": "WGNM",
            "username": "ionadmin",
            "planShortID": "6TGIO",
            "sampleDisplayedName": "",
            "prethumbnailbasecallerargs": "",
            "controlSequencekitname": null,
            "tfKey": "ATCG",
            "mixedTypeRNA_reference": "",
            "childPlans": [],
            "pairedEndLibraryAdapterName": "",
            "reverselibrarykey": "",
            "irworkflow": "",
            "planExecuted": false,
            "project": "",
            "usePostBeadfind": true,
            "libraryReadLength": 0,
            "runname": null,
            "chefInfo": {},
            "planGUID": "d1ed9718-b6f4-4dfd-8de5-bbd150092997",
            "ionstatsargs": "ionstats alignment",
            "samplePrepProtocol": "",
            "sample": "",
            "planExecutedDate": null,
            "reverse_primer": null,
            "id": 131,
            "barcodedSamples": {
                "Sample 6": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_006": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_006"
                    ]
                },
                "Sample 7": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_007": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_007"
                    ]
                },
                "Sample 4": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_004": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_004"
                    ]
                },
                "Sample 5": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_005": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_005"
                    ]
                },
                "Sample 2": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_002": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_002"
                    ]
                },
                "Sample 3": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_003": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_003"
                    ]
                },
                "Sample 1": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "SingleSeq_001": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "SingleSeq_001"
                    ]
                }
            },
            "custom_args": false,
            "regionfile": "",
            "selectedPlugins": {
                "FilterDuplicates": {
                    "userInput": "",
                    "version": "5.8.0.0",
                    "features": [],
                    "name": "FilterDuplicates",
                    "id": 34
                }
            },
            "beadfindargs": "justBeadFind --args-json /opt/ion/config/args_318_beadfind.json",
            "isSystemDefault": false,
            "autoName": null,
            "libraryKey": "TCAG",
            "flows": 250,
            "date": "2018-02-26T17:28:33.000588+00:00",
            "isSystem": false,
            "variantfrequency": "",
            "planName": "Ion_ReproSeq_Aneuploidy_-_Ion_PGM_System",
            "calibrateargs": "Calibration",
            "flowsInOrder": "",
            "libraryPrepType": "",
            "sampleGrouping": "/rundb/api/v1/samplegrouptype_cv/2/",
            "chipBarcode": "",
            "sampleSetDisplayedName": "",
            "usePreBeadfind": true,
            "resource_uri": "/rundb/api/v1/availableplannedexperimentsummary/131/",
            "libraryPrepTypeDisplayedName": "",
            "reverse3primeadapter": ""
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Chip Resource

Resource URL http://mytorrentserver/rundb/api/v1/chip/
Schema URL http://mytorrentserver/rundb/api/v1/chip/schema/

Resource Fields
field help text default nullable readonly blank unique type
name Unicode string data. Ex: “Hello World” n/a false false false false string
id Integer data. Ex: 2673   false false true true integer
earlyDatFileDeletion Unicode string data. Ex: “Hello World”   false false true false string
slots Integer data. Ex: 2673 n/a false false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
isActive Boolean data. Ex: True true false false true false boolean
description Unicode string data. Ex: “Hello World”   false false false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 28,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/chip/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "ionstatsargs": "ionstats alignment",
            "thumbnailionstatsargs": "",
            "thumbnailalignmentargs": "",
            "thumbnailanalysisargs": "",
            "slots": 1,
            "id": 1,
            "analysisargs": "Analysis --args-json /opt/ion/config/args_314_analysis.json",
            "thumbnailcalibrateargs": "",
            "beadfindargs": "justBeadFind --args-json /opt/ion/config/args_314_beadfind.json",
            "instrumentType": "pgm",
            "prebasecallerargs": "BaseCaller --barcode-filter-minreads 20",
            "description": "314v2",
            "prethumbnailbasecallerargs": "",
            "alignmentargs": "tmap mapall ... stage1 map4",
            "thumbnailbasecallerargs": "",
            "isActive": true,
            "thumbnailbeadfindargs": "",
            "calibrateargs": "Calibration",
            "name": "314",
            "basecallerargs": "BaseCaller --barcode-filter-minreads 20",
            "earlyDatFileDeletion": "",
            "resource_uri": "/rundb/api/v1/chip/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Cluster Info History Resource

Resource URL http://mytorrentserver/rundb/api/v1/clusterinfohistory/
Schema URL http://mytorrentserver/rundb/api/v1/clusterinfohistory/schema/

Resource Fields
field help text default nullable readonly blank unique type
username Unicode string data. Ex: “Hello World” ION false false true false string
name Unicode string data. Ex: “Hello World” n/a true true false false string
created A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
text Unicode string data. Ex: “Hello World”   false false false false string
object_pk Integer data. Ex: 2673 n/a false false false false integer
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Common Cv Resource

Resource URL http://mytorrentserver/rundb/api/v1/common_cv/
Schema URL http://mytorrentserver/rundb/api/v1/common_cv/schema/

Resource Fields
field help text default nullable readonly blank unique type
displayedValue Unicode string data. Ex: “Hello World” n/a false false false true string
sequencing_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
description Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
value Unicode string data. Ex: “Hello World” n/a false false false false string
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
cv_type Unicode string data. Ex: “Hello World” n/a false false false false string
isVisible Boolean data. Ex: True true false false true false boolean
uid Unicode string data. Ex: “Hello World” n/a false false false true string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
id Integer data. Ex: 2673   false false true true integer
isActive Boolean data. Ex: True true false false true false boolean
isDefault Boolean data. Ex: True true false false true false boolean
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 13,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/common_cv/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "displayedValue": "Ion PGM Hi-Q Chef for STR",
            "sequencing_instrumentType": "pgm",
            "description": "Use Ion Chef script protocol optimized for HID STR on PGM",
            "categories": "hidSamplePrep",
            "value": "anneal62no10xab",
            "samplePrep_instrumentType": "IC",
            "cv_type": "samplePrepProtocol",
            "isVisible": true,
            "uid": "CV0001",
            "resource_uri": "/rundb/api/v1/common_cv/1/",
            "id": 1,
            "isActive": true,
            "isDefault": false
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Composite Data Management Resource

Resource URL http://mytorrentserver/rundb/api/v1/compositedatamanagement/
Schema URL http://mytorrentserver/rundb/api/v1/compositedatamanagement/schema/

Resource Fields
field help text default nullable readonly blank unique type
basecall_state Unicode string data. Ex: “Hello World” Unknown false true false false string
in_process Boolean data. Ex: True false false false false false boolean
misc_state Unicode string data. Ex: “Hello World” Unknown false true false false string
timeStamp A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
basecall_keep Unicode string data. Ex: “Hello World” n/a true true false false string
misc_keep Unicode string data. Ex: “Hello World” n/a true true false false string
output_keep Unicode string data. Ex: “Hello World” n/a true true false false string
expName Unicode string data. Ex: “Hello World” n/a false true false false string
resultsName Unicode string data. Ex: “Hello World” n/a false false false false string
output_state Unicode string data. Ex: “Hello World” Unknown false true false false string
sigproc_state Unicode string data. Ex: “Hello World” Unknown false true false false string
sigproc_keep Unicode string data. Ex: “Hello World” n/a true true false false string
diskusage Integer data. Ex: 2673 n/a true false false false integer
expDir Unicode string data. Ex: “Hello World” n/a false true false false string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 6,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/compositedatamanagement/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "misc_diskspace": 0,
            "expName": "S5-540_WholeTranscriptomeRNA",
            "basecall_state": "Local",
            "in_process": false,
            "misc_state": "Deleted",
            "timeStamp": "2017-07-22T13:15:56.000197+00:00",
            "basecall_keep": false,
            "misc_keep": null,
            "output_keep": false,
            "basecall_diskspace": 175694.536458969,
            "resultsName": "Auto_S5-540_WholeTranscriptomeRNA_91",
            "output_state": "Error",
            "sigproc_state": "Local",
            "sigproc_keep": false,
            "sigproc_diskspace": 0.0160617828369141,
            "diskusage": 229301,
            "resource_uri": "/rundb/api/v1/compositedatamanagement/3/",
            "expDir": "/results/S5_DemoData/S5-540_WholeTranscriptomeRNA",
            "id": 3,
            "output_diskspace": 53607.1456193924
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Composite Experiment Resource

Resource URL http://mytorrentserver/rundb/api/mesh/v1/compositeexperiment/
Schema URL http://mytorrentserver/rundb/api/mesh/v1/compositeexperiment/schema/

Resource Fields
field help text default nullable readonly blank unique type
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chipType Unicode string data. Ex: “Hello World” n/a false false false false string
results Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
runMode Unicode string data. Ex: “Hello World”   false false true false string
chefStartTime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
_host Host this resource is located on. n/a false true false false string
id Integer data. Ex: 2673   false false true true integer
chefSolutionsSerialNum Unicode string data. Ex: “Hello World”   false false true false string
platform Unicode string data. Ex: “Hello World”   false false true false string
status Unicode string data. Ex: “Hello World”   false false true false string
star Boolean data. Ex: True false false false true false boolean
resultDate A date & time as a string. Ex: “2010-11-10T03:07:43” true true false false false datetime
flows Integer data. Ex: 2673 n/a false false false false integer
plan A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a false false false false datetime
ftpStatus Unicode string data. Ex: “Hello World”   false false true false string
displayName Unicode string data. Ex: “Hello World”   false false false false string
notes Unicode string data. Ex: “Hello World” n/a true false false false string
pgmName Unicode string data. Ex: “Hello World” n/a false false false false string
repResult A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
expName Unicode string data. Ex: “Hello World” n/a false false false false string
chefReagentsSerialNum Unicode string data. Ex: “Hello World”   false false true false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 8,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/mesh/v1/compositeexperiment/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "chipDescription": "540",
            "chipType": "540",
            "results": [
                {
                    "status": "Completed",
                    "processedflows": 0,
                    "libmetrics": {
                        "i100Q20_reads": 0,
                        "aveKeyCounts": 88,
                        "id": 1,
                        "resource_uri": "",
                        "q20_mean_alignment_length": 0
                    },
                    "representative": false,
                    "analysis_metrics": {
                        "ignored": 1042801,
                        "lib": 139085639,
                        "total_wells": 164699136,
                        "pinned": 2329,
                        "live": 140339912,
                        "excluded": 16543404,
                        "bead": 140400602,
                        "resource_uri": "",
                        "id": 1,
                        "empty": 6710000,
                        "libFinal": 93974105
                    },
                    "timeStamp": "2017-07-22T13:15:56.000197+00:00",
                    "analysismetrics": {
                        "ignored": 1042801,
                        "lib": 139085639,
                        "total_wells": 164699136,
                        "pinned": 2329,
                        "live": 140339912,
                        "excluded": 16543404,
                        "bead": 140400602,
                        "resource_uri": "",
                        "id": 1,
                        "empty": 6710000,
                        "libFinal": 93974105
                    },
                    "reportLink": "/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003/",
                    "reportStatus": "Nothing",
                    "quality_metrics": {
                        "q0_mean_read_length": 149.579903660696,
                        "q0_reads": 93969124,
                        "q0_bases": "14055892515",
                        "q20_reads": 93969124,
                        "q20_bases": "11916010889",
                        "q20_mean_read_length": 149,
                        "id": 1,
                        "resource_uri": ""
                    },
                    "resultsName": "Auto_S5-540_WholeTranscriptomeRNA_91",
                    "projects": [
                        {
                            "resource_uri": "",
                            "id": 1,
                            "name": "demo",
                            "modified": "2018-02-28T17:32:01.000703+00:00"
                        }
                    ],
                    "status_display": "Completed",
                    "qualitymetrics": {
                        "q0_mean_read_length": 149.579903660696,
                        "q0_reads": 93969124,
                        "q0_bases": "14055892515",
                        "q20_reads": 93969124,
                        "q20_bases": "11916010889",
                        "q20_mean_read_length": 149,
                        "id": 1,
                        "resource_uri": ""
                    },
                    "eas": {
                        "chipType": "540",
                        "reference": "",
                        "isPQ": false,
                        "references": "",
                        "barcodeKitName": "IonXpressRNA",
                        "resource_uri": ""
                    },
                    "resource_uri": "/rundb/api/v1/compositeresult/3/",
                    "id": 3,
                    "autoExempt": false,
                    "isShowAllMetrics": true
                }
            ],
            "library": "",
            "sample": "",
            "runMode": "single",
            "storage_options": "A",
            "references": "",
            "chefStartTime": null,
            "repResult": "/rundb/api/v1/compositeresult/3/",
            "id": 91,
            "barcodedSamples": {},
            "chefSolutionsSerialNum": "",
            "barcodeId": "IonXpressRNA",
            "sampleSetName": "",
            "platform": "S5",
            "status": "run",
            "applicationCategoryDisplayedName": "RNA Sequencing",
            "star": false,
            "sampleDisplayedName": "",
            "resultDate": "2017-07-22T13:15:56.000197+00:00",
            "flows": 500,
            "plan": {
                "runType": "RNA",
                "sampleTubeLabel": null,
                "id": 99,
                "resource_uri": ""
            },
            "date": "2017-02-21T12:59:23+00:00",
            "ftpStatus": "0",
            "displayName": "S5-540 WholeTranscriptomeRNA",
            "notes": "",
            "chipInstrumentType": "S5",
            "pgmName": "S16",
            "keep": false,
            "expName": "S5-540_WholeTranscriptomeRNA",
            "chefReagentsSerialNum": "",
            "resource_uri": "/rundb/api/mesh/v1/compositeexperiment/91/"
        }
    ],
    "warnings": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Composite Result Resource

Resource URL http://mytorrentserver/rundb/api/v1/compositeresult/
Schema URL http://mytorrentserver/rundb/api/v1/compositeresult/schema/

Resource Fields
field help text default nullable readonly blank unique type
status Unicode string data. Ex: “Hello World” n/a false false false false string
processedflows Integer data. Ex: 2673 n/a false false false false integer
timeStamp A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
analysismetrics A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
reportLink Unicode string data. Ex: “Hello World” n/a false false false false string
id Integer data. Ex: 2673   false false true true integer
reportStatus Unicode string data. Ex: “Hello World” Nothing true false false false string
resultsName Unicode string data. Ex: “Hello World” n/a false false false false string
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
qualitymetrics A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
eas A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
libmetrics A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
autoExempt Boolean data. Ex: True false false false true false boolean
representative Boolean data. Ex: True false false false true false boolean
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 7,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/compositeresult/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "status": "Completed",
            "processedflows": 0,
            "libmetrics": {
                "i100Q20_reads": 0,
                "aveKeyCounts": 88,
                "id": 1,
                "resource_uri": "",
                "q20_mean_alignment_length": 0
            },
            "representative": false,
            "analysis_metrics": {
                "ignored": 1042801,
                "lib": 139085639,
                "total_wells": 164699136,
                "pinned": 2329,
                "live": 140339912,
                "excluded": 16543404,
                "bead": 140400602,
                "resource_uri": "",
                "id": 1,
                "empty": 6710000,
                "libFinal": 93974105
            },
            "timeStamp": "2017-07-22T13:15:56.000197+00:00",
            "analysismetrics": {
                "ignored": 1042801,
                "lib": 139085639,
                "total_wells": 164699136,
                "pinned": 2329,
                "live": 140339912,
                "excluded": 16543404,
                "bead": 140400602,
                "resource_uri": "",
                "id": 1,
                "empty": 6710000,
                "libFinal": 93974105
            },
            "reportLink": "/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003/",
            "reportStatus": "Nothing",
            "quality_metrics": {
                "q0_mean_read_length": 149.579903660696,
                "q0_reads": 93969124,
                "q0_bases": "14055892515",
                "q20_reads": 93969124,
                "q20_bases": "11916010889",
                "q20_mean_read_length": 149,
                "id": 1,
                "resource_uri": ""
            },
            "resultsName": "Auto_S5-540_WholeTranscriptomeRNA_91",
            "projects": [
                {
                    "resource_uri": "",
                    "id": 1,
                    "name": "demo",
                    "modified": "2018-02-28T17:32:01.000703+00:00"
                }
            ],
            "qualitymetrics": {
                "q0_mean_read_length": 149.579903660696,
                "q0_reads": 93969124,
                "q0_bases": "14055892515",
                "q20_reads": 93969124,
                "q20_bases": "11916010889",
                "q20_mean_read_length": 149,
                "id": 1,
                "resource_uri": ""
            },
            "eas": {
                "chipType": "540",
                "reference": "",
                "isPQ": false,
                "references": "",
                "barcodeKitName": "IonXpressRNA",
                "resource_uri": ""
            },
            "resource_uri": "/rundb/api/v1/compositeresult/3/",
            "id": 3,
            "autoExempt": false,
            "isShowAllMetrics": true
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Content Resource

Resource URL http://mytorrentserver/rundb/api/v1/content/
Schema URL http://mytorrentserver/rundb/api/v1/content/schema/

Resource Fields
field help text default nullable readonly blank unique type
publisher A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
description Unicode string data. Ex: “Hello World”   false false true false string
extra Unicode string data. Ex: “Hello World”   false false true false string
contentupload A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
notes Unicode string data. Ex: “Hello World”   false false true false string
enabled Boolean data. Ex: True true false false true false boolean
upload_date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a false true false false datetime
application_tags Unicode string data. Ex: “Hello World”   false false true false string
meta Unicode string data. Ex: “Hello World” {} false false true false string
upload_id Unicode string data. Ex: “Hello World” n/a false true false false string
file Unicode string data. Ex: “Hello World” n/a false false false false string
path Unicode string data. Ex: “Hello World” n/a false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
type Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
name Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 31,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/content/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "publisher": "/rundb/api/v1/publisher/BED/",
            "description": "Noonan Panel",
            "extra": "hg19",
            "contentupload": "/rundb/api/v1/contentupload/1/",
            "notes": "",
            "enabled": true,
            "upload_date": "2018-01-16T18:30:05+00:00",
            "application_tags": "",
            "meta": {
                "upload_date": "2018-01-16T18:30:05",
                "description": "Noonan Panel",
                "reference": "hg19",
                "is_ampliseq": true,
                "hotspot": false,
                "choice": "pgm",
                "num_targets": 268,
                "num_genes": 14,
                "design": {
                    "number_of_amplicon_pools": 2,
                    "design_name": "Noonan Panel",
                    "configuration_choices": [],
                    "solution_name": null,
                    "id": 60011570,
                    "number_of_amplicons": 268,
                    "genome_reference": null,
                    "target_size": 26992,
                    "genome": "hg19",
                    "type": "COMMUNITY_PANEL",
                    "status": "ORDERABLE",
                    "min_number_amplicons_per_pool": 132,
                    "description": "<table class=\"design-template-info-wrapper-table\">\r\n    <tr>\r\n        <td colspan=\"3\">\r\n        <br>\r\n            <p>Noonan syndrome is a relatively common autosomal dominant congenital disorder with a high phenotypic variability. It is a clinically and genetically heterogeneous disorder that belongs to the group of Rasopathy diseases, caused by mutations in genes dysregulating the RAS/MAPK pathway.\r\nThe Noonan  Research Gene Panel has been developed in collaboration with an European consortia composed by  Marco Tartaglia(1), Jose Luis Costa (2), Kornelia Neveling and Marcel Nelen (3) . 1) Istituto Superiore di Sanit\u00e0, Rome, Italy, 2) Ipatimup, Porto 3) Human Genetics, Radboud UMC Nijmegen .\r\nThe panel assesses 14 genes known to be related with this disorder. <i>A2ML1</i>, <i>BRAF</i>, <i>CBL</i>, <i>HRAS</i>, <i>KRAS</i>, <i>MAP2K1</i>, <i>MAP2K2</i>, <i>NRAS</i>, <i>PTPN11</i>, <i>RAF1</i>, <i>RIT1</i>, <i>SHOC2</i>, <i>SOS1</i>, <i>SPRED1</i>. In a first study of 60 archived samples we showed that very high sensitivity and specificity are achievable. For further details see ASHG 2014 poster \u201cDevelopment and verification of a Noonan genes Ion AmpliSeq\u2122 panel\u201d M. Nelen et al.\r\n</p>\r\n        </td>\r\n    </tr>\r\n    <tr class=\"design-template-statistics\">\r\n        <td><strong>Design Date</strong></td>\r\n        <td colspan=\"2\" style=\"text-align: left\">\r\n            <b>Publication:</b> ASHG 2014 Poster \"Development and verification of a Noonan genes Ion AmpliSeq\u2122 panel\"<br/>\r\n            <b>Author:</b> Marcel Nelen (<a href='Marcel.Nelen@radboudumc.nl'>Marcel.Nelen@radboudumc.nl</a>)<br/>\r\n            <b>Affiliation:</b> Dept. of Human Genetics, Radboud university medical center, Nijmegen, The Netherlands<br/>\r\n        </td>\r\n    </tr>\r\n    <tr class=\"design-template-statistics\">\r\n        <td>\r\n            <strong>Recommended Application</strong>\r\n            Germ line mutation detection\r\n        </td>\r\n        <td>\r\n            <strong>Recommended Configuration</strong>\r\n            Sample per Chip: 8 per 318 chip<br/>\r\n            Minimum coverage: 684 \r\n        </td>\r\n        <td>\r\n            <strong>Sample Type</strong>\r\n            High molecular weight DNA\r\n        </td>\r\n    </tr>\r\n    <tr class=\"design-template-statistics\">\r\n        <td>\r\n            <strong>Number of sample in Publication</strong>\r\n            60 samples \r\n        </td>\r\n        <td>\r\n            <strong>Observed Performance</strong>\r\n            Panel uniformity: 93.05%<br/>\r\n            Reads on-targets: 98.42% \r\n        </td>\r\n        <td>\r\n            <strong>Input DNA required </strong>\r\n            2 pool<br/>\r\n            20 ng total\r\n        </td>\r\n    </tr>\r\n    <tr>\r\n        <td colspan=\"3\">\r\n            <b>Disease Research Area</b>: Developmental Disorders\r\n        </td>\r\n    </tr>\r\n</table>",
                    "results_uri": "/ws/tmpldesign/60011570/download/results",
                    "plan": {
                        "missed_bed": "WG_noonan.20150501.missed.bed",
                        "hotspot_bed": null,
                        "coverage_summary": "WG_noonan.20150501.results_coverage_summary.csv",
                        "designed_bed": "WG_noonan.20150501.designed.bed",
                        "target_mutations": null,
                        "primer_bed": null,
                        "runType": "AMPS",
                        "selectedPlugins": {},
                        "inputDna": "20 ng",
                        "coverage_detail": "WG_noonan.20150501.results_coverage_details.csv",
                        "primer_sequences": null,
                        "displayedPanelSize": "26.99 kb",
                        "submitted_bed": "WG_noonan.20150501.submitted.bed",
                        "well_plate_data": "WG_noonan.20150501.384WellPlateDataSheet.csv"
                    },
                    "design_id": "Noonan",
                    "pipeline": "DNA",
                    "request_id_and_solution_ordering_id": "Noonan",
                    "pipeline_version": null,
                    "created_date": "2015-05-22T20:52:38.703+0000",
                    "order_number": 0,
                    "amplicons_coverage_summary": 100
                },
                "pre_process_files": [
                    "WG_noonan.20150501.designed.bed",
                    "WG_noonan.20150501.missed.bed",
                    "WG_noonan.20150501.submitted.bed",
                    "WG_noonan.20150501.results_coverage_details.csv",
                    "WG_noonan.20150501.ampliconDataSheet.csv",
                    "WG_noonan.20150501.384WellPlateDataSheet.csv",
                    "WG_noonan.20150501.concentration.tab",
                    "WG_noonan.20150501.results_coverage_summary.csv",
                    "plan.json"
                ],
                "num_bases": 47724
            },
            "upload_id": "1",
            "file": "/results/uploads/BED/1/hg19/unmerged/plain/WG_noonan.20150501.designed.bed",
            "path": "/hg19/unmerged/plain/WG_noonan.20150501.designed.bed",
            "resource_uri": "/rundb/api/v1/content/1/",
            "type": "target",
            "id": 1,
            "name": "WG_noonan.20150501.designed.bed"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Content Upload Resource

Resource URL http://mytorrentserver/rundb/api/v1/contentupload/
Schema URL http://mytorrentserver/rundb/api/v1/contentupload/schema/

Resource Fields
field help text default nullable readonly blank unique type
status Unicode string data. Ex: “Hello World”   false false true false string
upload_date A date & time as a string. Ex: “2010-11-10T03:07:43” true true false false false datetime
name Unicode string data. Ex: “Hello World” n/a false true false false string
pub Unicode string data. Ex: “Hello World” n/a false true false false string
id Integer data. Ex: 2673   false false true true integer
username Unicode string data. Ex: “Hello World”   false false true false string
source Unicode string data. Ex: “Hello World”   false false true false string
meta Unicode string data. Ex: “Hello World” {} false false true false string
upload_type Unicode string data. Ex: “Hello World”   false false true false string
file_path Unicode string data. Ex: “Hello World” n/a false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 20,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/contentupload/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "status": "Successfully Completed",
            "upload_date": "2018-04-13T18:54:45.000418+00:00",
            "name": "gencode.v19.annotation_and_tRNAs.gtf",
            "pub": "refAnnot",
            "id": 21,
            "username": "ionadmin",
            "source": "http://updates.itw/internal_reference_downloads/hg19/gencode.v19.annotation_and_tRNAs.gtf",
            "meta": {
                "username": "ionadmin",
                "upload_date": "2018-04-13T18:54:45",
                "description": "hg19 and tRNA gene annotation file for smallRNA",
                "reference": "hg19",
                "url": "http://updates.itw/internal_reference_downloads/hg19/gencode.v19.annotation_and_tRNAs.gtf",
                "upload_type": "Annotation",
                "identity_hash": "c47c7d854a9767400224e119246494ec",
                "application_tags": "smallRNA",
                "updateversion": "1.0",
                "filesize": "1109491",
                "short_description": "hg19 and tRNA GTF annotation",
                "publication_date": "2018-02-14",
                "annot_type": "GTF"
            },
            "upload_type": "Annotation",
            "file_path": "/results/uploads/refAnnot/21/gencode.v19.annotation_and_tRNAs.gtf",
            "resource_uri": "/rundb/api/v1/contentupload/21/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Data Management History Resource

Resource URL http://mytorrentserver/rundb/api/v1/datamanagementhistory/
Schema URL http://mytorrentserver/rundb/api/v1/datamanagementhistory/schema/

Resource Fields
field help text default nullable readonly blank unique type
username Unicode string data. Ex: “Hello World” ION false false true false string
created A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
text Unicode string data. Ex: “Hello World”   false false false false string
object_pk Integer data. Ex: 2673 n/a false false false false integer
resultsName Unicode string data. Ex: “Hello World” n/a true true false false string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 36,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/datamanagementhistory/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "username": "ionadmin",
            "created": "2017-07-22T06:59:07.000501+00:00",
            "text": "Started from Local Basecalling Input /results/S5_DemoData/S5-530_cfDNA.",
            "object_pk": 1,
            "resultsName": "Auto_S5-530_cfDNA_89",
            "id": 8,
            "resource_uri": "/rundb/api/v1/datamanagementhistory/8/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Dna Barcode Resource

Resource URL http://mytorrentserver/rundb/api/v1/dnabarcode/
Schema URL http://mytorrentserver/rundb/api/v1/dnabarcode/schema/

Resource Fields
field help text default nullable readonly blank unique type
index Integer data. Ex: 2673 n/a false false false false integer
end_adapter Unicode string data. Ex: “Hello World”   false false true false string
name Unicode string data. Ex: “Hello World” n/a false false false false string
score_cutoff Floating point numeric data. Ex: 26.73 0 false false false false float
sequence Unicode string data. Ex: “Hello World” n/a false false false false string
is_end_barcode Boolean data. Ex: True false false false true false boolean
adapter Unicode string data. Ex: “Hello World”   false false true false string
system Boolean data. Ex: True false false false true false boolean
id Integer data. Ex: 2673   false false true true integer
length Integer data. Ex: 2673 0 false false true false integer
id_str Unicode string data. Ex: “Hello World” n/a false false false false string
active Boolean data. Ex: True true false false true false boolean
end_sequence Unicode string data. Ex: “Hello World”   false false true false string
score_mode Integer data. Ex: 2673 0 false false true false integer
type Unicode string data. Ex: “Hello World”   false false true false string
annotation Unicode string data. Ex: “Hello World”   false false true false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2090,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/dnabarcode/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "index": 1,
            "end_adapter": "",
            "name": "MuSeek_5prime_tag",
            "score_cutoff": 2,
            "sequence": "TTCA",
            "is_end_barcode": false,
            "adapter": "",
            "system": false,
            "id": 1,
            "length": 4,
            "id_str": "MuSeek_5prime_tag_001",
            "active": true,
            "end_sequence": "",
            "score_mode": 1,
            "type": "none",
            "annotation": "",
            "resource_uri": "/rundb/api/v1/dnabarcode/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Email Address Resource

Resource URL http://mytorrentserver/rundb/api/v1/emailaddress/
Schema URL http://mytorrentserver/rundb/api/v1/emailaddress/schema/

Resource Fields
field help text default nullable readonly blank unique type
selected Boolean data. Ex: True   false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
email Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Event Log Resource

Resource URL http://mytorrentserver/rundb/api/v1/eventlog/
Schema URL http://mytorrentserver/rundb/api/v1/eventlog/schema/

Resource Fields
field help text default nullable readonly blank unique type
username Unicode string data. Ex: “Hello World” ION false false true false string
created A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
text Unicode string data. Ex: “Hello World”   false false false false string
object_pk Integer data. Ex: 2673 n/a false false false false integer
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 56,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/eventlog/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "username": "ionadmin",
            "created": "2018-02-26T17:28:33.000742+00:00",
            "text": "Created Planned Run: Ion_ReproSeq_Aneuploidy_-_Ion_PGM_System (131)",
            "object_pk": 131,
            "id": 51,
            "resource_uri": "/rundb/api/v1/eventlog/51/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Experiment Resource

Resource URL http://mytorrentserver/rundb/api/v1/experiment/
Schema URL http://mytorrentserver/rundb/api/v1/experiment/schema/

Resource Fields
field help text default nullable readonly blank unique type
isReverseRun Boolean data. Ex: True false false false true false boolean
chefLotNumber Unicode string data. Ex: “Hello World”   false false true false string
chipType Unicode string data. Ex: “Hello World” n/a false false false false string
chefProtocolDeviationName Unicode string data. Ex: “Hello World” n/a true false false false string
chefReagentID Unicode string data. Ex: “Hello World”   false false true false string
results Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
chefSolutionsPart Unicode string data. Ex: “Hello World”   false false true false string
runtype Unicode string data. Ex: “Hello World” n/a false false false false string
chefLastUpdate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chefChipExpiration1 Unicode string data. Ex: “Hello World”   false false true false string
chefChipExpiration2 Unicode string data. Ex: “Hello World”   false false true false string
diskusage Integer data. Ex: 2673 n/a true false false false integer
chefStatus Unicode string data. Ex: “Hello World”   false false true false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
chefReagentsPart Unicode string data. Ex: “Hello World”   false false true false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
chefInstrumentName Unicode string data. Ex: “Hello World”   false false true false string
chefSolutionsSerialNum Unicode string data. Ex: “Hello World”   false false true false string
sample Unicode string data. Ex: “Hello World” n/a false true true false string
log Unicode string data. Ex: “Hello World” {} false false true false string
sequencekitbarcode Unicode string data. Ex: “Hello World” n/a true false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
eas_set Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
chefLogPath Unicode string data. Ex: “Hello World” n/a true false false false string
chefFlexibleWorkflow Unicode string data. Ex: “Hello World”   false false true false string
platform Unicode string data. Ex: “Hello World”   false false true false string
chefScriptVersion Unicode string data. Ex: “Hello World”   false false true false string
samples Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
chefOperationMode Unicode string data. Ex: “Hello World”   false false true false string
chefManufactureDate Unicode string data. Ex: “Hello World”   false false true false string
chefSamplePos Unicode string data. Ex: “Hello World”   false false true false string
pinnedRepResult Boolean data. Ex: True false false false true false boolean
chefReagentsExpiration Unicode string data. Ex: “Hello World”   false false true false string
chefSolutionsLot Unicode string data. Ex: “Hello World”   false false true false string
reagentBarcode Unicode string data. Ex: “Hello World”   false false true false string
chefProgress Floating point numeric data. Ex: 26.73 0 false false true false float
chefKitType Unicode string data. Ex: “Hello World”   false false true false string
star Boolean data. Ex: True false false false true false boolean
chefPackageVer Unicode string data. Ex: “Hello World”   false false true false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
isProton Unicode string data. Ex: “Hello World” n/a false true false false string
expCompInfo Unicode string data. Ex: “Hello World”   false false true false string
flowsInOrder Unicode string data. Ex: “Hello World”   false false true false string
flows Integer data. Ex: 2673 n/a false false false false integer
resultDate A date & time as a string. Ex: “2010-11-10T03:07:43” true true false false false datetime
chefTipRackBarcode Unicode string data. Ex: “Hello World”   false false true false string
chefRemainingSeconds Integer data. Ex: 2673 n/a true false false false integer
plan A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a false false false false datetime
chefExtraInfo_1 Unicode string data. Ex: “Hello World”   false false true false string
chefExtraInfo_2 Unicode string data. Ex: “Hello World”   false false true false string
unique Unicode string data. Ex: “Hello World” n/a false false false true string
expDir Unicode string data. Ex: “Hello World” n/a false false false false string
autoAnalyze Boolean data. Ex: True true false false true false boolean
ftpStatus Unicode string data. Ex: “Hello World”   false false true false string
chefMessage Unicode string data. Ex: “Hello World”   false false true false string
chefEndTime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
displayName Unicode string data. Ex: “Hello World”   false false false false string
pgmName Unicode string data. Ex: “Hello World” n/a false false false false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
notes Unicode string data. Ex: “Hello World” n/a true false false false string
sequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
chipBarcode Unicode string data. Ex: “Hello World”   false false true false string
chefStartTime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
chefSolutionsExpiration Unicode string data. Ex: “Hello World”   false false true false string
chefReagentsLot Unicode string data. Ex: “Hello World”   false false true false string
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World” n/a false false false false string
status Unicode string data. Ex: “Hello World”   false false true false string
chefReagentsSerialNum Unicode string data. Ex: “Hello World”   false false true false string
cycles Integer data. Ex: 2673 n/a false false false false integer
chefChipType2 Unicode string data. Ex: “Hello World”   false false true false string
chefChipType1 Unicode string data. Ex: “Hello World”   false false true false string
baselineRun Boolean data. Ex: True false false false true false boolean
user_ack Unicode string data. Ex: “Hello World” U false false false false string
rawdatastyle Unicode string data. Ex: “Hello World” single true false false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 112,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/experiment/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isReverseRun": false,
            "chefLotNumber": "",
            "chipType": "P1.1.17",
            "chefProtocolDeviationName": null,
            "chefReagentID": "",
            "results": [],
            "chefSolutionsPart": "",
            "runtype": "GENS",
            "chefLastUpdate": null,
            "storage_options": "A",
            "chefChipExpiration1": "",
            "chefChipExpiration2": "",
            "diskusage": null,
            "chefStatus": "",
            "reverse_primer": null,
            "seqKitBarcode": "",
            "id": 5,
            "chefReagentsPart": "",
            "metaData": {},
            "chefInstrumentName": "",
            "chefSolutionsSerialNum": "",
            "sample": "",
            "log": {},
            "sequencekitbarcode": "",
            "resource_uri": "/rundb/api/v1/experiment/5/",
            "eas_set": [
                {
                    "ionstatsargs": "",
                    "isEditable": true,
                    "endBarcodeKitName": "",
                    "hotSpotRegionBedFile": "",
                    "results": [],
                    "mixedTypeRNA_reference": null,
                    "mixedTypeRNA_targetRegionBedFile": null,
                    "targetRegionBedFile": "",
                    "thumbnailalignmentargs": "",
                    "thumbnailanalysisargs": "",
                    "id": 5,
                    "barcodedSamples": {},
                    "base_recalibration_mode": "standard_recal",
                    "reference": "",
                    "isOneTimeOverride": false,
                    "mixedTypeRNA_hotSpotRegionBedFile": null,
                    "analysisargs": "",
                    "thumbnailcalibrateargs": "",
                    "realign": false,
                    "selectedPlugins": {
                        "RNASeqAnalysis": {
                            "userInput": {},
                            "version": "5.8.0.0",
                            "features": [],
                            "name": "RNASeqAnalysis",
                            "id": 29
                        },
                        "PartekFlowUploader": {
                            "userInput": {},
                            "version": "1.0",
                            "features": [],
                            "name": "PartekFlowUploader",
                            "id": 9999
                        }
                    },
                    "experiment": "/rundb/api/v1/experiment/5/",
                    "barcodeKitName": "IonXpressRNA",
                    "beadfindargs": "",
                    "threePrimeAdapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
                    "thumbnailbasecallerargs": "",
                    "status": "planned",
                    "prebasecallerargs": "",
                    "thumbnailionstatsargs": "",
                    "prethumbnailbasecallerargs": "",
                    "alignmentargs": "",
                    "isDuplicateReads": false,
                    "libraryKey": "TCAG",
                    "date": "2018-01-12T19:38:34.000886+00:00",
                    "libraryKitName": "Ion Total RNA Seq Kit v2",
                    "thumbnailbeadfindargs": "",
                    "calibrateargs": "",
                    "tfKey": "ATCG",
                    "libraryKitBarcode": null,
                    "sseBedFile": "",
                    "basecallerargs": "",
                    "custom_args": false,
                    "resource_uri": "/rundb/api/v1/experimentanalysissettings/5/"
                }
            ],
            "chefLogPath": null,
            "chefFlexibleWorkflow": "",
            "platform": "PROTON",
            "chefScriptVersion": "",
            "samples": [],
            "chefOperationMode": "",
            "chefManufactureDate": "",
            "chefSamplePos": "",
            "pinnedRepResult": false,
            "chefReagentsExpiration": "",
            "chefSolutionsLot": "",
            "reagentBarcode": "",
            "chefProgress": 0,
            "chefKitType": "",
            "star": false,
            "chefPackageVer": "",
            "usePreBeadfind": false,
            "isProton": "True",
            "expCompInfo": "",
            "flowsInOrder": "",
            "flows": 500,
            "resultDate": "2017-07-22T06:41:42.000088+00:00",
            "chefTipRackBarcode": "",
            "chefRemainingSeconds": null,
            "plan": "/rundb/api/v1/plannedexperiment/20/",
            "date": "2017-07-22T06:41:42.000087+00:00",
            "chefExtraInfo_1": "",
            "chefExtraInfo_2": "",
            "unique": "39ef1391-032b-44d8-a7a1-d11dbb6028e2",
            "expDir": "",
            "autoAnalyze": true,
            "ftpStatus": "Complete",
            "chefMessage": "",
            "chefEndTime": null,
            "displayName": "NN4E0",
            "pgmName": "",
            "runMode": "single",
            "notes": "",
            "sequencekitname": "ProtonI200Kit-v3",
            "chipBarcode": "",
            "chefStartTime": null,
            "chefSolutionsExpiration": "",
            "chefReagentsLot": "",
            "storageHost": "",
            "expName": "39ef1391-032b-44d8-a7a1-d11dbb6028e2",
            "status": "planned",
            "chefReagentsSerialNum": "",
            "cycles": 0,
            "chefChipType2": "",
            "chefChipType1": "",
            "baselineRun": false,
            "user_ack": "U",
            "rawdatastyle": "single"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • PATCH
  • PUT
  • DELETE
Allowed detail HTTP methods
  • GET
  • PATCH
  • PUT
  • DELETE

Experiment Analysis Settings Resource

Resource URL http://mytorrentserver/rundb/api/v1/experimentanalysissettings/
Schema URL http://mytorrentserver/rundb/api/v1/experimentanalysissettings/schema/

Resource Fields
field help text default nullable readonly blank unique type
ionstatsargs Unicode string data. Ex: “Hello World”   false false true false string
isEditable Boolean data. Ex: True false false false true false boolean
endBarcodeKitName Unicode string data. Ex: “Hello World”   true false false false string
hotSpotRegionBedFile Unicode string data. Ex: “Hello World” n/a true false false false string
results Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
mixedTypeRNA_reference Unicode string data. Ex: “Hello World” n/a true false false false string
mixedTypeRNA_targetRegionBedFile Unicode string data. Ex: “Hello World” n/a true false false false string
targetRegionBedFile Unicode string data. Ex: “Hello World” n/a true false false false string
thumbnailalignmentargs Unicode string data. Ex: “Hello World”   false false true false string
thumbnailanalysisargs Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
barcodedSamples Unicode string data. Ex: “Hello World” {} true false false false string
base_recalibration_mode Unicode string data. Ex: “Hello World” standard_recal false false false false string
reference Unicode string data. Ex: “Hello World” n/a true false false false string
isOneTimeOverride Boolean data. Ex: True false false false true false boolean
mixedTypeRNA_hotSpotRegionBedFile Unicode string data. Ex: “Hello World” n/a true false false false string
analysisargs Unicode string data. Ex: “Hello World”   false false true false string
thumbnailcalibrateargs Unicode string data. Ex: “Hello World”   false false true false string
realign Boolean data. Ex: True false false false true false boolean
selectedPlugins Unicode string data. Ex: “Hello World” {} true false false false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
barcodeKitName Unicode string data. Ex: “Hello World” n/a true false false false string
beadfindargs Unicode string data. Ex: “Hello World”   false false true false string
threePrimeAdapter Unicode string data. Ex: “Hello World” n/a true false false false string
thumbnailbasecallerargs Unicode string data. Ex: “Hello World”   false false true false string
status Unicode string data. Ex: “Hello World”   false false true false string
prebasecallerargs Unicode string data. Ex: “Hello World”   false false true false string
thumbnailionstatsargs Unicode string data. Ex: “Hello World”   false false true false string
prethumbnailbasecallerargs Unicode string data. Ex: “Hello World”   false false true false string
alignmentargs Unicode string data. Ex: “Hello World”   false false true false string
isDuplicateReads Boolean data. Ex: True false false false true false boolean
libraryKey Unicode string data. Ex: “Hello World”   false false true false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
libraryKitName Unicode string data. Ex: “Hello World” n/a true false false false string
thumbnailbeadfindargs Unicode string data. Ex: “Hello World”   false false true false string
calibrateargs Unicode string data. Ex: “Hello World”   false false true false string
tfKey Unicode string data. Ex: “Hello World”   false false true false string
libraryKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
sseBedFile Unicode string data. Ex: “Hello World”   true false false false string
basecallerargs Unicode string data. Ex: “Hello World”   false false true false string
custom_args Boolean data. Ex: True false false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 112,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/experimentanalysissettings/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "ionstatsargs": "",
            "isEditable": true,
            "endBarcodeKitName": "",
            "hotSpotRegionBedFile": "",
            "results": [],
            "mixedTypeRNA_reference": null,
            "mixedTypeRNA_targetRegionBedFile": null,
            "targetRegionBedFile": "",
            "thumbnailalignmentargs": "",
            "thumbnailanalysisargs": "",
            "id": 2,
            "barcodedSamples": {},
            "base_recalibration_mode": "standard_recal",
            "reference": "",
            "isOneTimeOverride": false,
            "mixedTypeRNA_hotSpotRegionBedFile": null,
            "analysisargs": "",
            "thumbnailcalibrateargs": "",
            "realign": false,
            "selectedPlugins": {},
            "experiment": "/rundb/api/v1/experiment/2/",
            "barcodeKitName": "",
            "beadfindargs": "",
            "threePrimeAdapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
            "thumbnailbasecallerargs": "",
            "status": "planned",
            "prebasecallerargs": "",
            "thumbnailionstatsargs": "",
            "prethumbnailbasecallerargs": "",
            "alignmentargs": "",
            "isDuplicateReads": false,
            "libraryKey": "TCAG",
            "date": "2017-07-22T06:43:55.000629+00:00",
            "libraryKitName": "Ion Xpress Plus Fragment Library Kit",
            "thumbnailbeadfindargs": "",
            "calibrateargs": "",
            "tfKey": "ATCG",
            "libraryKitBarcode": null,
            "sseBedFile": "",
            "basecallerargs": "",
            "custom_args": false,
            "resource_uri": "/rundb/api/v1/experimentanalysissettings/2/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

File Monitor Resource

Resource URL http://mytorrentserver/rundb/api/v1/filemonitor/
Schema URL http://mytorrentserver/rundb/api/v1/filemonitor/schema/

Resource Fields
field help text default nullable readonly blank unique type
status Unicode string data. Ex: “Hello World”   false false false false string
updated A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
name Unicode string data. Ex: “Hello World”   false false false false string
created A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
url Unicode string data. Ex: “Hello World” n/a false false false false string
md5sum Unicode string data. Ex: “Hello World” None true false false false string
celery_task_id Unicode string data. Ex: “Hello World”   false false true false string
local_dir Unicode string data. Ex: “Hello World”   false false false false string
progress Unicode string data. Ex: “Hello World” 0 false false false false string
size Unicode string data. Ex: “Hello World” None true false false false string
id Integer data. Ex: 2673   false false true true integer
tags Unicode string data. Ex: “Hello World”   false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 9,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/filemonitor/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "status": "Complete",
            "updated": "2018-04-13T18:54:39.000796+00:00",
            "name": "gene.gtf",
            "created": "2018-04-13T18:54:08.000422+00:00",
            "url": "http://updates.itw/internal_reference_downloads/hg19/gene.gtf",
            "md5sum": "72fbd490a4d3be60e53e642d4401c944",
            "celery_task_id": "7db1de03-b295-4b62-9cdc-9cbb4c6065b0",
            "local_dir": "/tmp/tmppTeNvf",
            "progress": "1111970946",
            "size": "1111970946",
            "id": 7,
            "tags": "annotation",
            "resource_uri": "/rundb/api/v1/filemonitor/7/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

File Server Resource

Resource URL http://mytorrentserver/rundb/api/v1/fileserver/
Schema URL http://mytorrentserver/rundb/api/v1/fileserver/schema/

Resource Fields
field help text default nullable readonly blank unique type
percentfull Floating point numeric data. Ex: 26.73 0 true false false false float
name Unicode string data. Ex: “Hello World” n/a false false false false string
filesPrefix Unicode string data. Ex: “Hello World” n/a false false false false string
comments Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 1,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": [
        {
            "percentfull": 39.0445528646121,
            "name": "Home",
            "filesPrefix": "/results/",
            "comments": "",
            "id": 1,
            "resource_uri": "/rundb/api/v1/fileserver/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Flow Order Resource

Resource URL http://mytorrentserver/rundb/api/v1/floworder/
Schema URL http://mytorrentserver/rundb/api/v1/floworder/schema/

Resource Fields
field help text default nullable readonly blank unique type
description Unicode string data. Ex: “Hello World”   false false true false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
flowOrder Unicode string data. Ex: “Hello World”   false false true false string
isActive Boolean data. Ex: True true false false true false boolean
isSystem Boolean data. Ex: True false false false true false boolean
id Integer data. Ex: 2673   false false true true integer
isDefault Boolean data. Ex: True false false false true false boolean
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 7,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/floworder/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "description": "Ion contradanzon flow order",
            "resource_uri": "/rundb/api/v1/floworder/3/",
            "flowOrder": "TACGTACGTAGCTTGACGTACGTCATGCATCGATCAGCTAAGCTGACGTAGCTAGCATCGATCCAGTCATGACTGACGTAGCTGACTGGATCAGTCATGCATCG",
            "isActive": false,
            "isSystem": true,
            "id": 3,
            "isDefault": false,
            "name": "Ion contradanzon"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Get Chef Cartridgeusage Resource

Resource URL http://mytorrentserver/rundb/api/v1/getchefcartridgeusage/
Schema URL http://mytorrentserver/rundb/api/v1/getchefcartridgeusage/schema/

Resource Fields
field help text default nullable readonly blank unique type
hoursSinceSolutionFirstUse Integer number of hours between (oldest associated experiment using Solution) and (chefCurrentTime). Rounded down to the nearest hour is OK. Ex: 24 n/a true true true false Integer
numberSolutionSerialUsage Integer number. No of Solution cartridge Usage Ex: 2 n/a true true true false Integer
errorCodes A lists of data. Ex: [“E200”] or [“W100”, “W200”] n/a true true true false List Object
allowRunToContinue Boolean string data. Ex: “true or false” n/a true true true false boolean
detailMessages A dictionary of data. Ex: {‘E300’: ‘No. of reagent and solution usage do not match’} n/a true true true false dict
numberReagentSerialUsage Integer number. No of Reagent cartridge Usage Ex: 2 n/a true true true false Integer
hoursSinceReagentFirstUse Integer number of hours between (oldest associated experiment using Reagent) and (chefCurrentTime). Rounded down to the nearest hour is OK. Ex: 48 n/a true true true false Integer
Example Response
{
    "hoursSinceSolutionFirstUse": "",
    "numberSolutionSerialUsage": 0,
    "errorCodes": [
        "E305"
    ],
    "allowRunToContinue": false,
    "detailMessages": {
        "E305": "Missing chef inputs filter option ['chefReagentsSerialNum', 'chefSolutionsSerialNum', 'kitName']"
    },
    "numberReagentSerialUsage": 0,
    "hoursSinceReagentFirstUse": ""
}
Allowed list HTTP methods
  • GET
Allowed detail HTTP methods

None

Get Chef Script Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/getchefscriptinfo/
Schema URL http://mytorrentserver/rundb/api/v1/getchefscriptinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
availableversion A dictionary of data. Ex: {‘Compatible_Chef_release’: [‘IC.5.4.0’], ‘IS_scripts’: ‘00515’} n/a true true true false dict
Example Response
{
    "object": {
        "availableversion": {
            "IS_scripts": "000803",
            "Compatible_Chef_release": [
                "IC.5.10.0"
            ]
        }
    }
}
Allowed list HTTP methods
  • GET
Allowed detail HTTP methods

None

Global Config Resource

Resource URL http://mytorrentserver/rundb/api/v1/globalconfig/
Schema URL http://mytorrentserver/rundb/api/v1/globalconfig/schema/

Resource Fields
field help text default nullable readonly blank unique type
enable_version_lock Boolean data. Ex: True false false false true false boolean
site_name Unicode string data. Ex: “Hello World”   false false true false string
enable_support_upload Boolean data. Ex: True false false false true false boolean
plugin_output_folder Unicode string data. Ex: “Hello World”   false false true false string
auto_archive_ack Boolean data. Ex: True false false false true false boolean
enable_compendia_OCP Boolean data. Ex: True false false false true false boolean
id Integer data. Ex: 2673   false false true true integer
base_recalibration_mode Unicode string data. Ex: “Hello World” standard_recal false false false false string
default_storage_options Unicode string data. Ex: “Hello World” D false false true false string
selected Boolean data. Ex: True   false false true false boolean
check_news_posts Boolean data. Ex: True true false false true false boolean
realign Boolean data. Ex: True false false false true false boolean
ts_update_status Unicode string data. Ex: “Hello World”   false false true false string
mark_duplicates Boolean data. Ex: True false false false true false boolean
auto_archive_enable Boolean data. Ex: True false false false true false boolean
enable_auto_security Boolean data. Ex: True true false false true false boolean
enable_nightly_email Boolean data. Ex: True true false false true false boolean
sec_update_status Unicode string data. Ex: “Hello World”   false false true false string
default_flow_order Unicode string data. Ex: “Hello World”   false false true false string
name Unicode string data. Ex: “Hello World” n/a false false false false string
records_to_display Integer data. Ex: 2673 20 false false true false integer
telemetry_enabled Boolean data. Ex: True true false false true false boolean
default_library_key Unicode string data. Ex: “Hello World”   false false true false string
cluster_auto_disable Boolean data. Ex: True true false false true false boolean
web_root Unicode string data. Ex: “Hello World”   false false true false string
default_test_fragment_key Unicode string data. Ex: “Hello World”   false false true false string
enable_auto_pkg_dl Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 1,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": [
        {
            "enable_version_lock": false,
            "site_name": "Torrent Server",
            "enable_support_upload": false,
            "plugin_output_folder": "plugin_out",
            "auto_archive_ack": true,
            "enable_compendia_OCP": true,
            "id": 1,
            "base_recalibration_mode": "standard_recal",
            "default_storage_options": "A",
            "selected": false,
            "check_news_posts": true,
            "realign": false,
            "ts_update_status": "Ready to install",
            "mark_duplicates": false,
            "auto_archive_enable": true,
            "enable_auto_security": true,
            "enable_nightly_email": true,
            "sec_update_status": "",
            "default_flow_order": "TACG",
            "name": "Config",
            "records_to_display": 20,
            "telemetry_enabled": true,
            "default_library_key": "TCAG",
            "cluster_auto_disable": true,
            "web_root": "",
            "default_test_fragment_key": "ATCG",
            "enable_auto_pkg_dl": true,
            "resource_uri": "/rundb/api/v1/globalconfig/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Ion Chef Plan Template Resource

Resource URL http://mytorrentserver/rundb/api/v1/ionchefplantemplate/
Schema URL http://mytorrentserver/rundb/api/v1/ionchefplantemplate/schema/

Resource Fields
field help text default nullable readonly blank unique type
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
autoAnalyze Boolean data. Ex: True n/a false false false false boolean
endBarcodeKitName Unicode string data. Ex: “Hello World”   true false true false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
mixedTypeRNA_hotSpotRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_targetRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
platform Unicode string data. Ex: “Hello World” n/a true false true false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
notes Unicode string data. Ex: “Hello World”   true false true false string
sequencekitname Unicode string data. Ex: “Hello World”   true false true false string
base_recalibration_mode Unicode string data. Ex: “Hello World”   true false true false string
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
cycles Integer data. Ex: 2673 n/a true false false false integer
isReverseRun Boolean data. Ex: True false false false true false boolean
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chipType Unicode string data. Ex: “Hello World”   false false false false string
library Unicode string data. Ex: “Hello World”   true false true false string
reverselibrarykey Unicode string data. Ex: “Hello World”   false true false false string
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
barcodeId Unicode string data. Ex: “Hello World”   true false true false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
realign Boolean data. Ex: True n/a false false false false boolean
sampleGroupingName Unicode string data. Ex: “Hello World” n/a true true true false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
bedfile Unicode string data. Ex: “Hello World”   false false true false string
applicationCategoryDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
isReusable Boolean data. Ex: True false false false true false boolean
isDuplicateReads Boolean data. Ex: True n/a false false false false boolean
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
librarykitname Unicode string data. Ex: “Hello World”   true false true false string
sseBedFile Unicode string data. Ex: “Hello World”   false false true false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
earlyDatFileDeletion Boolean data. Ex: True false false true false false boolean
parentPlan Unicode string data. Ex: “Hello World” None false false true false string
origin Unicode string data. Ex: “Hello World”   true false false false string
forward3primeadapter Unicode string data. Ex: “Hello World”   true false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroupDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
qcValues Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
planStatus Unicode string data. Ex: “Hello World”   false false true false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
username Unicode string data. Ex: “Hello World” n/a true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
sampleDisplayedName Unicode string data. Ex: “Hello World”   true false true false string
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
tfKey Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_reference Unicode string data. Ex: “Hello World”   true false true false string
childPlans A list of data. Ex: [‘abc’, 26.73, 8] [] false false false false list
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
project Unicode string data. Ex: “Hello World” n/a false true true false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
chefInfo A dictionary of data. Ex: {‘price’: 26.73, ‘name’: ‘Daniel’} {} false false false false dict
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
sample Unicode string data. Ex: “Hello World”   true false true false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
barcodedSamples Unicode string data. Ex: “Hello World”   true false true false string
regionfile Unicode string data. Ex: “Hello World”   false false true false string
selectedPlugins Unicode string data. Ex: “Hello World”   true false true false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
libraryKey Unicode string data. Ex: “Hello World”   false false true false string
flows Integer data. Ex: 2673 0 false false false false integer
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
variantfrequency Unicode string data. Ex: “Hello World”   false true false false string
sampleSetDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
flowsInOrder Unicode string data. Ex: “Hello World”   true false true false string
libraryPrepType Unicode string data. Ex: “Hello World”   true true true false string
sampleGrouping A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
chipBarcode Unicode string data. Ex: “Hello World”   false false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
libraryPrepTypeDisplayedName Unicode string data. Ex: “Hello World”   true true true false string
reverse3primeadapter Unicode string data. Ex: “Hello World”   false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 66,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/ionchefplantemplate/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "planDisplayedName": "Ion AmpliSeq HD for Tumor - DNA and Fusions - Separate Libraries",
            "autoAnalyze": true,
            "endBarcodeKitName": "",
            "templatingKitBarcode": null,
            "preAnalysis": true,
            "thumbnailanalysisargs": "",
            "applicationGroup": "/rundb/api/v1/applicationgroup/5/",
            "mixedTypeRNA_hotSpotRegionBedFile": null,
            "mixedTypeRNA_targetRegionBedFile": null,
            "platform": "S5",
            "categories": "onco_solidTumor;onco_heme;",
            "planPGM": "",
            "prebasecallerargs": "",
            "alignmentargs": "",
            "thumbnailbasecallerargs": "",
            "libkit": null,
            "projects": [],
            "notes": "",
            "sequencekitname": "Ion S5 Sequencing Kit",
            "base_recalibration_mode": "standard_recal",
            "storageHost": null,
            "expName": "",
            "thumbnailionstatsargs": "",
            "cycles": null,
            "isReverseRun": false,
            "storage_options": "A",
            "thumbnailalignmentargs": "",
            "chipType": "540",
            "library": "hg19",
            "runMode": "single",
            "sampleTubeLabel": null,
            "seqKitBarcode": null,
            "barcodeId": "Ion AmpliSeq HD Dual Barcode Kit 1-24",
            "isPlanGroup": false,
            "realign": false,
            "sampleGroupingName": "DNA and Fusions",
            "experiment": "/rundb/api/v1/experiment/134/",
            "bedfile": "",
            "applicationCategoryDisplayedName": "Oncology - Solid Tumor | Oncology - HemeOnc",
            "isReusable": true,
            "isDuplicateReads": false,
            "sampleSets": [],
            "thumbnailbeadfindargs": "",
            "librarykitname": "Ion AmpliSeq HD Library Kit",
            "sseBedFile": "",
            "adapter": null,
            "basecallerargs": "",
            "earlyDatFileDeletion": false,
            "parentPlan": null,
            "origin": "|5.10.0.RC4",
            "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
            "planStatus": "planned",
            "isCustom_kitSettings": false,
            "samplePrepKitName": null,
            "applicationGroupDisplayedName": "DNA and Fusions (Separate Libraries)",
            "metaData": {},
            "isFavorite": false,
            "qcValues": [
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/141/",
                    "id": 400,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Bead Loading (%)",
                        "id": 1,
                        "resource_uri": "/rundb/api/v1/qctype/1/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/400/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/141/",
                    "id": 401,
                    "qcType": {
                        "description": "",
                        "minThreshold": 1,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Key Signal (1-100)",
                        "id": 2,
                        "resource_uri": "/rundb/api/v1/qctype/2/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/401/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/141/",
                    "id": 402,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Usable Sequence (%)",
                        "id": 3,
                        "resource_uri": "/rundb/api/v1/qctype/3/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/402/"
                }
            ],
            "analysisargs": "",
            "thumbnailcalibrateargs": "",
            "templatingKitName": "Ion Chef S540 V1",
            "runType": "AMPS_HD_DNA_RNA",
            "username": null,
            "planShortID": "A628Z",
            "sampleDisplayedName": "",
            "prethumbnailbasecallerargs": "",
            "controlSequencekitname": null,
            "tfKey": "ATCG",
            "mixedTypeRNA_reference": null,
            "childPlans": [],
            "pairedEndLibraryAdapterName": null,
            "reverselibrarykey": "",
            "irworkflow": "",
            "planExecuted": false,
            "project": "",
            "usePostBeadfind": false,
            "libraryReadLength": 200,
            "runname": null,
            "chefInfo": {},
            "planGUID": "e52fac66-4086-433e-b8e7-ad1d1403946f",
            "ionstatsargs": "",
            "samplePrepProtocol": "",
            "sample": "",
            "planExecutedDate": null,
            "reverse_primer": null,
            "id": 141,
            "barcodedSamples": {},
            "custom_args": false,
            "regionfile": "",
            "selectedPlugins": {
                "coverageAnalysis": {
                    "userInput": {},
                    "version": "5.8.0.8",
                    "features": [],
                    "name": "coverageAnalysis",
                    "id": 41
                },
                "variantCaller": {
                    "userInput": {
                        "meta": {
                            "configuration": "ampliseq_hd_ffpe"
                        }
                    },
                    "version": "5.8.0.19",
                    "features": [],
                    "name": "variantCaller",
                    "id": 36
                }
            },
            "beadfindargs": "",
            "isSystemDefault": false,
            "autoName": null,
            "libraryKey": "TCAG",
            "flows": 500,
            "date": "2018-04-12T05:54:10.000222+00:00",
            "isSystem": true,
            "variantfrequency": "",
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA_and_Fusions_-_Separate_Libraries",
            "calibrateargs": "",
            "flowsInOrder": "",
            "libraryPrepType": "",
            "sampleGrouping": "/rundb/api/v1/samplegrouptype_cv/6/",
            "chipBarcode": "",
            "sampleSetDisplayedName": "",
            "usePreBeadfind": true,
            "resource_uri": "/rundb/api/v1/ionchefplantemplate/141/",
            "libraryPrepTypeDisplayedName": "",
            "reverse3primeadapter": ""
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Ion Chef Plan Template Summary Resource

Resource URL http://mytorrentserver/rundb/api/v1/ionchefplantemplatesummary/
Schema URL http://mytorrentserver/rundb/api/v1/ionchefplantemplatesummary/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
username Unicode string data. Ex: “Hello World” n/a true false false false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 66,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/ionchefplantemplatesummary/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "origin": "|5.10.0.RC4",
            "isReverseRun": false,
            "planDisplayedName": "Ion AmpliSeq HD for Tumor - DNA and Fusions - Separate Libraries",
            "storage_options": "A",
            "preAnalysis": true,
            "planShortID": "A628Z",
            "planStatus": "planned",
            "runMode": "single",
            "isCustom_kitSettings": false,
            "sampleTubeLabel": null,
            "planExecutedDate": null,
            "samplePrepKitName": null,
            "reverse_primer": null,
            "seqKitBarcode": null,
            "id": 141,
            "metaData": {},
            "isFavorite": false,
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "templatingKitName": "Ion Chef S540 V1",
            "runType": "AMPS_HD_DNA_RNA",
            "templatingKitBarcode": null,
            "planPGM": "",
            "isSystemDefault": false,
            "autoName": null,
            "isReusable": true,
            "controlSequencekitname": null,
            "date": "2018-04-12T05:54:10.000222+00:00",
            "isSystem": true,
            "libkit": null,
            "categories": "onco_solidTumor;onco_heme;",
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA_and_Fusions_-_Separate_Libraries",
            "pairedEndLibraryAdapterName": null,
            "adapter": null,
            "irworkflow": "",
            "planExecuted": false,
            "username": null,
            "usePostBeadfind": false,
            "storageHost": null,
            "expName": "",
            "libraryReadLength": 200,
            "runname": null,
            "usePreBeadfind": true,
            "planGUID": "e52fac66-4086-433e-b8e7-ad1d1403946f",
            "cycles": null,
            "resource_uri": "/rundb/api/v1/ionchefplantemplatesummary/141/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Ion Chef Prep Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/ionchefprepkitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/ionchefprepkitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 14,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/ionchefprepkitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "IC",
            "kitType": "IonChefPrepKit",
            "description": "Precision ID Chef Reagents",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "S5",
            "chipTypes": "510;520;530",
            "runMode": "",
            "parts": [
                {
                    "barcode": "A32882C",
                    "id": 20246,
                    "resource_uri": "/rundb/api/v1/kitpart/20246/",
                    "kit": "/rundb/api/v1/kitinfo/20106/"
                }
            ],
            "flowCount": 0,
            "applicationType": "AMPS",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/ionchefprepkitinfo/20106/",
            "uid": "ICPREP0011",
            "id": 20106,
            "categories": "filter_s5HidKit;samplePrepProtocol;s5hidSamplePrep",
            "name": "Ion Chef HID S530 V2"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Ion Mesh Node Resource

Resource URL http://mytorrentserver/rundb/api/v1/ionmeshnode/
Schema URL http://mytorrentserver/rundb/api/v1/ionmeshnode/schema/

Resource Fields
field help text default nullable readonly blank unique type
apikey_local Unicode string data. Ex: “Hello World” n/a true false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
hostname Unicode string data. Ex: “Hello World” n/a false false false true string
system_id Unicode string data. Ex: “Hello World” n/a false false false true string
active Boolean data. Ex: True true false false true false boolean
apikey_remote Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
name Unicode string data. Ex: “Hello World” n/a true false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 1,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": [
        {
            "apikey_local": "2ef92cb0069d1d1b156fa081ec1717807c1cd105",
            "resource_uri": "/rundb/api/v1/ionmeshnode/4/",
            "hostname": "tsvm.itw",
            "system_id": "tsvm",
            "active": true,
            "apikey_remote": "f45e8c2251095469140a12bf47349d72c68422e9",
            "id": 4,
            "name": ""
        }
    ]
}
Allowed list HTTP methods
  • PATCH
  • GET
  • DELETE
Allowed detail HTTP methods
  • PATCH
  • GET
  • DELETE

Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/kitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/kitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
defaultFlowOrder A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
name Unicode string data. Ex: “Hello World” n/a false false false true string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 114,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/kitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": false,
            "samplePrep_instrumentType": "",
            "kitType": "ControlSequenceKit",
            "defaultFlowOrder": null,
            "name": "Ion PGM Controls Kit v2",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "pgm",
            "chipTypes": "",
            "runMode": "",
            "parts": [
                {
                    "barcode": "4482010",
                    "id": 20072,
                    "resource_uri": "/rundb/api/v1/kitpart/20072/",
                    "kit": "/rundb/api/v1/kitinfo/20037/"
                },
                {
                    "barcode": "4482011",
                    "id": 20073,
                    "resource_uri": "/rundb/api/v1/kitpart/20073/",
                    "kit": "/rundb/api/v1/kitinfo/20037/"
                }
            ],
            "flowCount": 0,
            "applicationType": "",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/kitinfo/20037/",
            "uid": "CONSEQ0003",
            "id": 20037,
            "categories": "",
            "description": "Ion PGM Controls Kit v2"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Kit Part Resource

Resource URL http://mytorrentserver/rundb/api/v1/kitpart/
Schema URL http://mytorrentserver/rundb/api/v1/kitpart/schema/

Resource Fields
field help text default nullable readonly blank unique type
barcode Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
kit A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 263,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/kitpart/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "barcode": "100020580",
            "id": 20086,
            "resource_uri": "/rundb/api/v1/kitpart/20086/",
            "kit": "/rundb/api/v1/kitinfo/20042/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Lib Metrics Resource

Resource URL http://mytorrentserver/rundb/api/v1/libmetrics/
Schema URL http://mytorrentserver/rundb/api/v1/libmetrics/schema/

Resource Fields
field help text default nullable readonly blank unique type
i350Q17_reads Integer data. Ex: 2673 n/a false false false false integer
i150Q47_reads Integer data. Ex: 2673 n/a false false false false integer
i300Q47_reads Integer data. Ex: 2673 n/a false false false false integer
i600Q20_reads Integer data. Ex: 2673 n/a false false false false integer
i300Q20_reads Integer data. Ex: 2673 n/a false false false false integer
i250Q17_reads Integer data. Ex: 2673 n/a false false false false integer
q10_longest_alignment Integer data. Ex: 2673 n/a false false false false integer
i50Q10_reads Integer data. Ex: 2673 n/a false false false false integer
aveKeyCounts Floating point numeric data. Ex: 26.73 n/a false false false false float
i50Q17_reads Integer data. Ex: 2673 n/a false false false false integer
total_mapped_target_bases Unicode string data. Ex: “Hello World” n/a false false false false string
i200Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i100Q47_reads Integer data. Ex: 2673 n/a false false false false integer
i50Q20_reads Integer data. Ex: 2673 n/a false false false false integer
i450Q7_reads Integer data. Ex: 2673 n/a false false false false integer
genomesize Unicode string data. Ex: “Hello World” n/a false false false false string
i550Q20_reads Integer data. Ex: 2673 n/a false false false false integer
report A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
i450Q47_reads Integer data. Ex: 2673 n/a false false false false integer
dr Floating point numeric data. Ex: 26.73 n/a false false false false float
i150Q17_reads Integer data. Ex: 2673 n/a false false false false integer
q7_mapped_bases Unicode string data. Ex: “Hello World” n/a false false false false string
i350Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i500Q20_reads Integer data. Ex: 2673 n/a false false false false integer
q20_mapped_bases Unicode string data. Ex: “Hello World” n/a false false false false string
i250Q47_reads Integer data. Ex: 2673 n/a false false false false integer
q47_longest_alignment Integer data. Ex: 2673 n/a false false false false integer
i550Q17_reads Integer data. Ex: 2673 n/a false false false false integer
i50Q47_reads Integer data. Ex: 2673 n/a false false false false integer
i200Q17_reads Integer data. Ex: 2673 n/a false false false false integer
i250Q20_reads Integer data. Ex: 2673 n/a false false false false integer
q47_alignments Integer data. Ex: 2673 n/a false false false false integer
align_sample Integer data. Ex: 2673 n/a false false false false integer
i100Q10_reads Integer data. Ex: 2673 n/a false false false false integer
i350Q20_reads Integer data. Ex: 2673 n/a false false false false integer
i100Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i400Q17_reads Integer data. Ex: 2673 n/a false false false false integer
i500Q47_reads Integer data. Ex: 2673 n/a false false false false integer
i450Q20_reads Integer data. Ex: 2673 n/a false false false false integer
q7_mean_alignment_length Integer data. Ex: 2673 n/a false false false false integer
q7_alignments Integer data. Ex: 2673 n/a false false false false integer
total_mapped_reads Unicode string data. Ex: “Hello World” n/a false false false false string
i600Q10_reads Integer data. Ex: 2673 n/a false false false false integer
i250Q10_reads Integer data. Ex: 2673 n/a false false false false integer
cf Floating point numeric data. Ex: 26.73 n/a false false false false float
i500Q7_reads Integer data. Ex: 2673 n/a false false false false integer
q10_mapped_bases Unicode string data. Ex: “Hello World” n/a false false false false string
i550Q7_reads Integer data. Ex: 2673 n/a false false false false integer
duplicate_reads Integer data. Ex: 2673 n/a true false false false integer
i350Q47_reads Integer data. Ex: 2673 n/a false false false false integer
totalNumReads Integer data. Ex: 2673 n/a false false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
i350Q10_reads Integer data. Ex: 2673 n/a false false false false integer
i300Q10_reads Integer data. Ex: 2673 n/a false false false false integer
q20_mean_alignment_length Integer data. Ex: 2673 n/a false false false false integer
i250Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i200Q10_reads Integer data. Ex: 2673 n/a false false false false integer
i400Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i200Q47_reads Integer data. Ex: 2673 n/a false false false false integer
q7_longest_alignment Integer data. Ex: 2673 n/a false false false false integer
i500Q10_reads Integer data. Ex: 2673 n/a false false false false integer
Genome_Version Unicode string data. Ex: “Hello World” n/a false false false false string
i400Q20_reads Integer data. Ex: 2673 n/a false false false false integer
q10_alignments Integer data. Ex: 2673 n/a false false false false integer
i450Q17_reads Integer data. Ex: 2673 n/a false false false false integer
i100Q20_reads Integer data. Ex: 2673 n/a false false false false integer
i550Q10_reads Integer data. Ex: 2673 n/a false false false false integer
i450Q10_reads Integer data. Ex: 2673 n/a false false false false integer
i400Q47_reads Integer data. Ex: 2673 n/a false false false false integer
q17_longest_alignment Integer data. Ex: 2673 n/a false false false false integer
i150Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i400Q10_reads Integer data. Ex: 2673 n/a false false false false integer
q10_mean_alignment_length Integer data. Ex: 2673 n/a false false false false integer
raw_accuracy Floating point numeric data. Ex: 26.73 n/a false false false false float
sysSNR Floating point numeric data. Ex: 26.73 n/a false false false false float
q17_mapped_bases Unicode string data. Ex: “Hello World” n/a false false false false string
Index_Version Unicode string data. Ex: “Hello World” n/a false false false false string
i300Q17_reads Integer data. Ex: 2673 n/a false false false false integer
q17_mean_alignment_length Integer data. Ex: 2673 n/a false false false false integer
ie Floating point numeric data. Ex: 26.73 n/a false false false false float
id Integer data. Ex: 2673   false false true true integer
q20_alignments Integer data. Ex: 2673 n/a false false false false integer
q47_mapped_bases Unicode string data. Ex: “Hello World” n/a false false false false string
genome Unicode string data. Ex: “Hello World” n/a false false false false string
i300Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i150Q20_reads Integer data. Ex: 2673 n/a false false false false integer
i550Q47_reads Integer data. Ex: 2673 n/a false false false false integer
i600Q47_reads Integer data. Ex: 2673 n/a false false false false integer
i100Q17_reads Integer data. Ex: 2673 n/a false false false false integer
q47_mean_alignment_length Integer data. Ex: 2673 n/a false false false false integer
i50Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i600Q7_reads Integer data. Ex: 2673 n/a false false false false integer
i600Q17_reads Integer data. Ex: 2673 n/a false false false false integer
q17_alignments Integer data. Ex: 2673 n/a false false false false integer
i500Q17_reads Integer data. Ex: 2673 n/a false false false false integer
i150Q10_reads Integer data. Ex: 2673 n/a false false false false integer
q20_longest_alignment Integer data. Ex: 2673 n/a false false false false integer
i200Q20_reads Integer data. Ex: 2673 n/a false false false false integer
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 6,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/libmetrics/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "i350Q17_reads": 0,
            "i150Q47_reads": 0,
            "i300Q47_reads": 0,
            "i600Q20_reads": 0,
            "i300Q20_reads": 0,
            "i250Q17_reads": 0,
            "q10_longest_alignment": 0,
            "i50Q10_reads": 0,
            "aveKeyCounts": 88,
            "i50Q17_reads": 0,
            "total_mapped_target_bases": "0",
            "i200Q7_reads": 0,
            "i100Q47_reads": 0,
            "i50Q20_reads": 0,
            "i450Q7_reads": 0,
            "genomesize": "0",
            "i550Q20_reads": 0,
            "report": "/rundb/api/v1/results/3/",
            "i450Q47_reads": 0,
            "dr": 0.168037705589086,
            "i150Q17_reads": 0,
            "q7_mapped_bases": "0",
            "i350Q7_reads": 0,
            "i500Q20_reads": 0,
            "q20_mapped_bases": "0",
            "i250Q47_reads": 0,
            "q47_longest_alignment": 0,
            "i550Q17_reads": 0,
            "i50Q47_reads": 0,
            "i200Q17_reads": 0,
            "i250Q20_reads": 0,
            "q47_alignments": 0,
            "align_sample": -1,
            "i100Q10_reads": 0,
            "i350Q20_reads": 0,
            "i100Q7_reads": 0,
            "i400Q17_reads": 0,
            "i500Q47_reads": 0,
            "i450Q20_reads": 0,
            "q7_mean_alignment_length": 0,
            "q7_alignments": 0,
            "total_mapped_reads": "0",
            "i600Q10_reads": 0,
            "i250Q10_reads": 0,
            "cf": 0.603865925222635,
            "i500Q7_reads": 0,
            "q10_mapped_bases": "0",
            "i550Q7_reads": 0,
            "duplicate_reads": null,
            "i350Q47_reads": 0,
            "totalNumReads": 93969124,
            "resource_uri": "/rundb/api/v1/libmetrics/1/",
            "i350Q10_reads": 0,
            "i300Q10_reads": 0,
            "q20_mean_alignment_length": 0,
            "i250Q7_reads": 0,
            "i200Q10_reads": 0,
            "i400Q7_reads": 0,
            "i200Q47_reads": 0,
            "q7_longest_alignment": 0,
            "i500Q10_reads": 0,
            "Genome_Version": "None",
            "i400Q20_reads": 0,
            "q10_alignments": 0,
            "i450Q17_reads": 0,
            "i100Q20_reads": 0,
            "i550Q10_reads": 0,
            "i450Q10_reads": 0,
            "i400Q47_reads": 0,
            "q17_longest_alignment": 0,
            "i150Q7_reads": 0,
            "i400Q10_reads": 0,
            "q10_mean_alignment_length": 0,
            "raw_accuracy": 0,
            "sysSNR": 0.103568483421323,
            "q17_mapped_bases": "0",
            "Index_Version": "None",
            "i300Q17_reads": 0,
            "q17_mean_alignment_length": 0,
            "ie": 0.465626595541835,
            "id": 1,
            "q20_alignments": 0,
            "q47_mapped_bases": "0",
            "genome": "None",
            "i300Q7_reads": 0,
            "i150Q20_reads": 0,
            "i550Q47_reads": 0,
            "i600Q47_reads": 0,
            "i100Q17_reads": 0,
            "q47_mean_alignment_length": 0,
            "i50Q7_reads": 0,
            "i600Q7_reads": 0,
            "i600Q17_reads": 0,
            "q17_alignments": 0,
            "i500Q17_reads": 0,
            "i150Q10_reads": 0,
            "q20_longest_alignment": 0,
            "i200Q20_reads": 0
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Library Key Resource

Resource URL http://mytorrentserver/rundb/api/v1/librarykey/
Schema URL http://mytorrentserver/rundb/api/v1/librarykey/schema/

Resource Fields
field help text default nullable readonly blank unique type
direction Unicode string data. Ex: “Hello World” Forward false false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
sequence Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World” single false false true false string
id Integer data. Ex: 2673   false false true true integer
isDefault Boolean data. Ex: True false false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 3,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/librarykey/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "direction": "Forward",
            "name": "Ion TCAG",
            "sequence": "TCAG",
            "description": "Default forward library key",
            "runMode": "single",
            "id": 1,
            "isDefault": true,
            "resource_uri": "/rundb/api/v1/librarykey/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Library Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/librarykitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/librarykitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 27,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/librarykitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "",
            "kitType": "LibraryKit",
            "description": "MuSeek Library Preparation Kit",
            "nucleotideType": "dna",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "",
            "chipTypes": "",
            "runMode": "",
            "parts": [],
            "flowCount": 0,
            "applicationType": "GENS",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/librarykitinfo/20025/",
            "uid": "LIB0012",
            "id": 20025,
            "categories": "filter_muSeek",
            "name": "MuSeek(tm) Library Preparation Kit"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Library Kit Part Resource

Resource URL http://mytorrentserver/rundb/api/v1/librarykitpart/
Schema URL http://mytorrentserver/rundb/api/v1/librarykitpart/schema/

Resource Fields
field help text default nullable readonly blank unique type
barcode Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
kit A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 35,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/librarykitpart/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "barcode": "A31204",
            "id": 20243,
            "resource_uri": "/rundb/api/v1/librarykitpart/20243/",
            "kit": "/rundb/api/v1/kitinfo/20103/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Location Resource

Resource URL http://mytorrentserver/rundb/api/v1/location/
Schema URL http://mytorrentserver/rundb/api/v1/location/schema/

Resource Fields
field help text default nullable readonly blank unique type
name Unicode string data. Ex: “Hello World” n/a false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
defaultlocation Only one location can be the default false false false true false boolean
comments Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/location/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "name": "Disabled",
            "resource_uri": "/rundb/api/v1/location/2/",
            "defaultlocation": false,
            "comments": "A location which will not be assigned to any File Servers so that Rigs assigned to this location will not be treated as valid Rigs when ionCrawler attempts to find new raw data directories. This is so that we do not have to delete a Rig from the Rigs table but still want to prevent new Experiments from appearing associated with the Rig.",
            "id": 2
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Log Resource

Resource URL http://mytorrentserver/rundb/api/v1/log/
Schema URL http://mytorrentserver/rundb/api/v1/log/schema/

Resource Fields
field help text default nullable readonly blank unique type
text Unicode string data. Ex: “Hello World”   false false true false string
timeStamp A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
upload A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Message Resource

Resource URL http://mytorrentserver/rundb/api/v1/message/
Schema URL http://mytorrentserver/rundb/api/v1/message/schema/

Resource Fields
field help text default nullable readonly blank unique type
body Unicode string data. Ex: “Hello World”   false false true false string
status Unicode string data. Ex: “Hello World” unread false false true false string
level Integer data. Ex: 2673 20 false false false false integer
route Unicode string data. Ex: “Hello World”   false false true false string
expires Unicode string data. Ex: “Hello World” read false false true false string
time A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
id Integer data. Ex: 2673   false false true true integer
tags Unicode string data. Ex: “Hello World”   false false true false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 1,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": [
        {
            "body": "There is an update available for your Torrent Server. <a class=\"btn btn-success\" href=\"/admin/update\">Update Now</a>",
            "status": "unread",
            "level": 20,
            "route": "_StaffOnly",
            "expires": "read",
            "time": "2018-06-15T18:51:37.000649+00:00",
            "id": 40,
            "tags": "new-upgrade",
            "resource_uri": "/rundb/api/v1/message/40/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Monitor Data Resource

Resource URL http://mytorrentserver/rundb/api/v1/monitordata/
Schema URL http://mytorrentserver/rundb/api/v1/monitordata/schema/

Resource Fields
field help text default nullable readonly blank unique type
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
treeDat Unicode string data. Ex: “Hello World” {} false false true false string
id Integer data. Ex: 2673   false false true true integer
name Unicode string data. Ex: “Hello World”   false false false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Monitor Result Resource

Resource URL http://mytorrentserver/rundb/api/v1/monitorresult/
Schema URL http://mytorrentserver/rundb/api/v1/monitorresult/schema/

Resource Fields
field help text default nullable readonly blank unique type
status Unicode string data. Ex: “Hello World” n/a false false false false string
processedflows Integer data. Ex: 2673 n/a false false false false integer
libmetrics A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
timeStamp A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
analysismetrics A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
reportLink Unicode string data. Ex: “Hello World” n/a false false false false string
library Unicode string data. Ex: “Hello World” n/a true true false false string
id Integer data. Ex: 2673   false false true true integer
reportStatus Unicode string data. Ex: “Hello World” Nothing true false false false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
resultsName Unicode string data. Ex: “Hello World” n/a false false false false string
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
qualitymetrics A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
eas A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
barcodeId Unicode string data. Ex: “Hello World” n/a true true false false string
autoExempt Boolean data. Ex: True false false false true false boolean
representative Boolean data. Ex: True false false false true false boolean
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Network Resource

Resource URL http://mytorrentserver/rundb/api/v1/network/
Schema URL http://mytorrentserver/rundb/api/v1/network/schema/

Resource Fields
field help text default nullable readonly blank unique type
eth_device Unicode string data. Ex: “Hello World” n/a true true true false boolean
external_ip Unicode string data. Ex: “Hello World” n/a true true true false string
internal_ip Unicode string data. Ex: “Hello World” n/a true true true false string
route Unicode string data. Ex: “Hello World” n/a true true true false boolean
Example Response
{
    "eth_device": true,
    "external_ip": "12.27.71.34",
    "internal_ip": "10.45.2.119",
    "route": true
}
Allowed list HTTP methods
  • GET
Allowed detail HTTP methods

None

Onetouch Plan Template Resource

Resource URL http://mytorrentserver/rundb/api/v1/onetouchplantemplate/
Schema URL http://mytorrentserver/rundb/api/v1/onetouchplantemplate/schema/

Resource Fields
field help text default nullable readonly blank unique type
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
autoAnalyze Boolean data. Ex: True n/a false false false false boolean
endBarcodeKitName Unicode string data. Ex: “Hello World”   true false true false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
mixedTypeRNA_hotSpotRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_targetRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
platform Unicode string data. Ex: “Hello World” n/a true false true false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
notes Unicode string data. Ex: “Hello World”   true false true false string
sequencekitname Unicode string data. Ex: “Hello World”   true false true false string
base_recalibration_mode Unicode string data. Ex: “Hello World”   true false true false string
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
cycles Integer data. Ex: 2673 n/a true false false false integer
isReverseRun Boolean data. Ex: True false false false true false boolean
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chipType Unicode string data. Ex: “Hello World”   false false false false string
library Unicode string data. Ex: “Hello World”   true false true false string
reverselibrarykey Unicode string data. Ex: “Hello World”   false true false false string
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
barcodeId Unicode string data. Ex: “Hello World”   true false true false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
realign Boolean data. Ex: True n/a false false false false boolean
sampleGroupingName Unicode string data. Ex: “Hello World” n/a true true true false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
bedfile Unicode string data. Ex: “Hello World”   false false true false string
applicationCategoryDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
isReusable Boolean data. Ex: True false false false true false boolean
isDuplicateReads Boolean data. Ex: True n/a false false false false boolean
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
librarykitname Unicode string data. Ex: “Hello World”   true false true false string
sseBedFile Unicode string data. Ex: “Hello World”   false false true false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
earlyDatFileDeletion Boolean data. Ex: True false false true false false boolean
parentPlan Unicode string data. Ex: “Hello World” None false false true false string
origin Unicode string data. Ex: “Hello World”   true false false false string
forward3primeadapter Unicode string data. Ex: “Hello World”   true false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroupDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
qcValues Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
planStatus Unicode string data. Ex: “Hello World”   false false true false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
username Unicode string data. Ex: “Hello World” n/a true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
sampleDisplayedName Unicode string data. Ex: “Hello World”   true false true false string
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
tfKey Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_reference Unicode string data. Ex: “Hello World”   true false true false string
childPlans A list of data. Ex: [‘abc’, 26.73, 8] [] false false false false list
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
project Unicode string data. Ex: “Hello World” n/a false true true false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
chefInfo A dictionary of data. Ex: {‘price’: 26.73, ‘name’: ‘Daniel’} {} false false false false dict
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
sample Unicode string data. Ex: “Hello World”   true false true false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
barcodedSamples Unicode string data. Ex: “Hello World”   true false true false string
regionfile Unicode string data. Ex: “Hello World”   false false true false string
selectedPlugins Unicode string data. Ex: “Hello World”   true false true false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
libraryKey Unicode string data. Ex: “Hello World”   false false true false string
flows Integer data. Ex: 2673 0 false false false false integer
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
variantfrequency Unicode string data. Ex: “Hello World”   false true false false string
sampleSetDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
flowsInOrder Unicode string data. Ex: “Hello World”   true false true false string
libraryPrepType Unicode string data. Ex: “Hello World”   true true true false string
sampleGrouping A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
chipBarcode Unicode string data. Ex: “Hello World”   false false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
libraryPrepTypeDisplayedName Unicode string data. Ex: “Hello World”   true true true false string
reverse3primeadapter Unicode string data. Ex: “Hello World”   false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 37,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/onetouchplantemplate/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "planDisplayedName": "PGx Research Panel",
            "autoAnalyze": true,
            "endBarcodeKitName": "",
            "templatingKitBarcode": null,
            "preAnalysis": true,
            "thumbnailanalysisargs": "",
            "applicationGroup": "/rundb/api/v1/applicationgroup/6/",
            "mixedTypeRNA_hotSpotRegionBedFile": null,
            "mixedTypeRNA_targetRegionBedFile": null,
            "platform": "PGM",
            "categories": "",
            "planPGM": null,
            "prebasecallerargs": "",
            "alignmentargs": "",
            "thumbnailbasecallerargs": "",
            "libkit": null,
            "projects": [],
            "notes": "",
            "sequencekitname": "IonPGMHiQ",
            "base_recalibration_mode": "standard_recal",
            "storageHost": null,
            "expName": "",
            "thumbnailionstatsargs": "",
            "cycles": null,
            "isReverseRun": false,
            "storage_options": "A",
            "thumbnailalignmentargs": "",
            "chipType": "",
            "library": "hg19",
            "runMode": "",
            "sampleTubeLabel": null,
            "seqKitBarcode": null,
            "barcodeId": "IonXpress",
            "isPlanGroup": false,
            "realign": false,
            "sampleGroupingName": "",
            "experiment": "/rundb/api/v1/experiment/122/",
            "bedfile": "/results/uploads/BED/5/hg19/unmerged/detail/PGx.20150728.designed.bed",
            "applicationCategoryDisplayedName": "",
            "isReusable": true,
            "isDuplicateReads": false,
            "sampleSets": [],
            "thumbnailbeadfindargs": "",
            "librarykitname": "Ion AmpliSeq 2.0 Library Kit",
            "sseBedFile": "",
            "adapter": null,
            "basecallerargs": "",
            "earlyDatFileDeletion": false,
            "parentPlan": null,
            "origin": "ampliseq.com|5.8.0",
            "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
            "planStatus": "planned",
            "isCustom_kitSettings": false,
            "samplePrepKitName": null,
            "applicationGroupDisplayedName": "Pharmacogenomics",
            "metaData": {},
            "isFavorite": false,
            "qcValues": [],
            "analysisargs": "",
            "thumbnailcalibrateargs": "",
            "templatingKitName": "Ion PGM Hi-Q OT2 Kit - 200",
            "runType": "AMPS",
            "username": "ionuser",
            "planShortID": "OO9C5",
            "sampleDisplayedName": "",
            "prethumbnailbasecallerargs": "",
            "controlSequencekitname": "",
            "tfKey": "ATCG",
            "mixedTypeRNA_reference": null,
            "childPlans": [],
            "pairedEndLibraryAdapterName": "",
            "reverselibrarykey": "",
            "irworkflow": "",
            "planExecuted": false,
            "project": "",
            "usePostBeadfind": true,
            "libraryReadLength": 0,
            "runname": null,
            "chefInfo": {},
            "planGUID": "7489c32d-d3ed-4cc1-a7a2-e59b819ea395",
            "ionstatsargs": "",
            "samplePrepProtocol": "",
            "sample": "",
            "planExecutedDate": null,
            "reverse_primer": null,
            "id": 130,
            "barcodedSamples": {},
            "custom_args": false,
            "regionfile": "/results/uploads/BED/15/hg19/unmerged/detail/PGx.20180131.hotspots.bed",
            "selectedPlugins": {
                "variantCaller": {
                    "features": [],
                    "ampliSeqVariantCallerConfig": {
                        "torrent_variant_caller": {
                            "snp_min_allele_freq": "0.1",
                            "snp_strand_bias": "0.95",
                            "hotspot_min_coverage": 6,
                            "hotspot_min_cov_each_strand": 3,
                            "position_bias": "0.75",
                            "hotspot_min_allele_freq": "0.1",
                            "snp_min_variant_score": 10,
                            "mnp_min_variant_score": 10,
                            "hotspot_strand_bias": "0.98",
                            "hp_max_length": 10,
                            "filter_insertion_predictions": "0.4",
                            "indel_min_variant_score": 10,
                            "indel_min_coverage": 15,
                            "heavy_tailed": 3,
                            "outlier_probability": "0.01",
                            "position_bias_ref_fraction": "0.05",
                            "indel_strand_bias_pval": 1,
                            "data_quality_stringency": "6.5",
                            "snp_min_cov_each_strand": 0,
                            "indel_as_hpindel": 0,
                            "snp_strand_bias_pval": 1,
                            "mnp_strand_bias": "0.95",
                            "mnp_strand_bias_pval": 1,
                            "process_input_positions_only": 1,
                            "hotspot_strand_bias_pval": "0.01",
                            "hotspot_min_variant_score": 4,
                            "do_mnp_realignment": 1,
                            "indel_strand_bias": "0.85",
                            "downsample_to_coverage": 4000,
                            "filter_unusual_predictions": "0.7",
                            "indel_min_allele_freq": "0.1",
                            "mnp_min_allele_freq": "0.1",
                            "mnp_min_coverage": 6,
                            "do_snp_realignment": 1,
                            "mnp_min_cov_each_strand": 0,
                            "snp_min_coverage": 6,
                            "prediction_precision": 1,
                            "indel_min_cov_each_strand": 5,
                            "filter_deletion_predictions": "0.2",
                            "realignment_threshold": 1,
                            "suppress_recalibration": 0,
                            "position_bias_pval": "0.05",
                            "use_position_bias": 0
                        },
                        "meta": {
                            "repository_id": "",
                            "ts_version": "5.0",
                            "name": "PGx - Germ Line - Customized parameters",
                            "user_selections": {
                                "chip": "pgm",
                                "frequency": "germline",
                                "library": "ampliseq",
                                "panel": "/rundb/api/v1/contentupload/15/"
                            },
                            "tooltip": "Panel-optimized parameters from AmpliSeq.com",
                            "tvcargs": "tvc --use-input-allele-only",
                            "built_in": true,
                            "configuration": "PGx_germline_low_stringency",
                            "compatibility": {
                                "panel": "/rundb/api/v1/contentupload/15/"
                            }
                        },
                        "long_indel_assembler": {
                            "min_indel_size": 4,
                            "short_suffix_match": 5,
                            "output_mnv": 0,
                            "min_var_count": 5,
                            "min_var_freq": "0.15",
                            "kmer_len": 19,
                            "max_hp_length": 8,
                            "relative_strand_bias": "0.8"
                        },
                        "freebayes": {
                            "gen_min_coverage": 10,
                            "allow_mnps": 1,
                            "allow_complex": 0,
                            "read_snp_limit": 10,
                            "read_max_mismatch_fraction": 1,
                            "allow_indels": 1,
                            "min_mapping_qv": 4,
                            "gen_min_alt_allele_freq": "0.15",
                            "allow_snps": 1,
                            "gen_min_indel_alt_allele_freq": "0.15"
                        }
                    },
                    "userInput": {
                        "torrent_variant_caller": {
                            "snp_min_allele_freq": "0.1",
                            "snp_strand_bias": "0.95",
                            "hotspot_min_coverage": 6,
                            "hotspot_min_cov_each_strand": 3,
                            "position_bias": "0.75",
                            "hotspot_min_allele_freq": "0.1",
                            "snp_min_variant_score": 10,
                            "mnp_min_variant_score": 10,
                            "hotspot_strand_bias": "0.98",
                            "hp_max_length": 10,
                            "filter_insertion_predictions": "0.4",
                            "indel_min_variant_score": 10,
                            "indel_min_coverage": 15,
                            "heavy_tailed": 3,
                            "outlier_probability": "0.01",
                            "position_bias_ref_fraction": "0.05",
                            "indel_strand_bias_pval": 1,
                            "data_quality_stringency": "6.5",
                            "snp_min_cov_each_strand": 0,
                            "indel_as_hpindel": 0,
                            "snp_strand_bias_pval": 1,
                            "mnp_strand_bias": "0.95",
                            "mnp_strand_bias_pval": 1,
                            "process_input_positions_only": 1,
                            "hotspot_strand_bias_pval": "0.01",
                            "hotspot_min_variant_score": 4,
                            "do_mnp_realignment": 1,
                            "indel_strand_bias": "0.85",
                            "downsample_to_coverage": 4000,
                            "filter_unusual_predictions": "0.7",
                            "indel_min_allele_freq": "0.1",
                            "mnp_min_allele_freq": "0.1",
                            "mnp_min_coverage": 6,
                            "do_snp_realignment": 1,
                            "mnp_min_cov_each_strand": 0,
                            "snp_min_coverage": 6,
                            "prediction_precision": 1,
                            "indel_min_cov_each_strand": 5,
                            "filter_deletion_predictions": "0.2",
                            "realignment_threshold": 1,
                            "suppress_recalibration": 0,
                            "position_bias_pval": "0.05",
                            "use_position_bias": 0
                        },
                        "meta": {
                            "repository_id": "",
                            "ts_version": "5.0",
                            "name": "PGx - Germ Line - Customized parameters",
                            "user_selections": {
                                "chip": "pgm",
                                "frequency": "germline",
                                "library": "ampliseq",
                                "panel": "/rundb/api/v1/contentupload/15/"
                            },
                            "tooltip": "Panel-optimized parameters from AmpliSeq.com",
                            "tvcargs": "tvc --use-input-allele-only",
                            "built_in": true,
                            "configuration": "PGx_germline_low_stringency",
                            "compatibility": {
                                "panel": "/rundb/api/v1/contentupload/15/"
                            }
                        },
                        "long_indel_assembler": {
                            "min_indel_size": 4,
                            "short_suffix_match": 5,
                            "output_mnv": 0,
                            "min_var_count": 5,
                            "min_var_freq": "0.15",
                            "kmer_len": 19,
                            "max_hp_length": 8,
                            "relative_strand_bias": "0.8"
                        },
                        "freebayes": {
                            "gen_min_coverage": 10,
                            "allow_mnps": 1,
                            "allow_complex": 0,
                            "read_snp_limit": 10,
                            "read_max_mismatch_fraction": 1,
                            "allow_indels": 1,
                            "min_mapping_qv": 4,
                            "gen_min_alt_allele_freq": "0.15",
                            "allow_snps": 1,
                            "gen_min_indel_alt_allele_freq": "0.15"
                        }
                    },
                    "version": "5.8.0.19",
                    "id": 36,
                    "name": "variantCaller"
                }
            },
            "beadfindargs": "",
            "isSystemDefault": false,
            "autoName": null,
            "libraryKey": "TCAG",
            "flows": 500,
            "date": "2018-02-08T19:41:44.000698+00:00",
            "isSystem": false,
            "variantfrequency": "",
            "planName": "PGx_Research_Panel",
            "calibrateargs": "",
            "flowsInOrder": "",
            "libraryPrepType": "",
            "sampleGrouping": null,
            "chipBarcode": "",
            "sampleSetDisplayedName": "",
            "usePreBeadfind": true,
            "resource_uri": "/rundb/api/v1/onetouchplantemplate/130/",
            "libraryPrepTypeDisplayedName": "",
            "reverse3primeadapter": ""
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Onetouch Plan Template Summary Resource

Resource URL http://mytorrentserver/rundb/api/v1/onetouchplantemplatesummary/
Schema URL http://mytorrentserver/rundb/api/v1/onetouchplantemplatesummary/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
username Unicode string data. Ex: “Hello World” n/a true false false false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 37,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/onetouchplantemplatesummary/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "origin": "ampliseq.com|5.8.0",
            "isReverseRun": false,
            "planDisplayedName": "PGx Research Panel",
            "storage_options": "A",
            "preAnalysis": true,
            "planShortID": "OO9C5",
            "planStatus": "planned",
            "runMode": "",
            "isCustom_kitSettings": false,
            "sampleTubeLabel": null,
            "planExecutedDate": null,
            "samplePrepKitName": null,
            "reverse_primer": null,
            "seqKitBarcode": null,
            "id": 130,
            "metaData": {},
            "isFavorite": false,
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "templatingKitName": "Ion PGM Hi-Q OT2 Kit - 200",
            "runType": "AMPS",
            "templatingKitBarcode": null,
            "planPGM": null,
            "isSystemDefault": false,
            "autoName": null,
            "isReusable": true,
            "controlSequencekitname": "",
            "date": "2018-02-08T19:41:44.000698+00:00",
            "isSystem": false,
            "libkit": null,
            "categories": "",
            "planName": "PGx_Research_Panel",
            "pairedEndLibraryAdapterName": "",
            "adapter": null,
            "irworkflow": "",
            "planExecuted": false,
            "username": "ionuser",
            "usePostBeadfind": true,
            "storageHost": null,
            "expName": "",
            "libraryReadLength": 0,
            "runname": null,
            "usePreBeadfind": true,
            "planGUID": "7489c32d-d3ed-4cc1-a7a2-e59b819ea395",
            "cycles": null,
            "resource_uri": "/rundb/api/v1/onetouchplantemplatesummary/130/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Planned Experiment Resource

Resource URL http://mytorrentserver/rundb/api/v1/plannedexperiment/
Schema URL http://mytorrentserver/rundb/api/v1/plannedexperiment/schema/

Resource Fields
field help text default nullable readonly blank unique type
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
autoAnalyze Boolean data. Ex: True n/a false false false false boolean
endBarcodeKitName Unicode string data. Ex: “Hello World”   true false true false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
mixedTypeRNA_hotSpotRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_targetRegionBedFile Unicode string data. Ex: “Hello World”   false false true false string
platform Unicode string data. Ex: “Hello World” n/a true false true false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
notes Unicode string data. Ex: “Hello World”   true false true false string
sequencekitname Unicode string data. Ex: “Hello World”   true false true false string
base_recalibration_mode Unicode string data. Ex: “Hello World”   true false true false string
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
cycles Integer data. Ex: 2673 n/a true false false false integer
isReverseRun Boolean data. Ex: True false false false true false boolean
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chipType Unicode string data. Ex: “Hello World”   false false false false string
library Unicode string data. Ex: “Hello World”   true false true false string
reverselibrarykey Unicode string data. Ex: “Hello World”   false true false false string
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
barcodeId Unicode string data. Ex: “Hello World”   true false true false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
realign Boolean data. Ex: True n/a false false false false boolean
sampleGroupingName Unicode string data. Ex: “Hello World” n/a true true true false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
bedfile Unicode string data. Ex: “Hello World”   false false true false string
applicationCategoryDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
isReusable Boolean data. Ex: True false false false true false boolean
isDuplicateReads Boolean data. Ex: True n/a false false false false boolean
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
librarykitname Unicode string data. Ex: “Hello World”   true false true false string
sseBedFile Unicode string data. Ex: “Hello World”   false false true false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
earlyDatFileDeletion Boolean data. Ex: True false false true false false boolean
parentPlan Unicode string data. Ex: “Hello World” None false false true false string
origin Unicode string data. Ex: “Hello World”   true false false false string
forward3primeadapter Unicode string data. Ex: “Hello World”   true false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroupDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
qcValues Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
planStatus Unicode string data. Ex: “Hello World”   false false true false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
username Unicode string data. Ex: “Hello World” n/a true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
sampleDisplayedName Unicode string data. Ex: “Hello World”   true false true false string
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
tfKey Unicode string data. Ex: “Hello World”   false false true false string
mixedTypeRNA_reference Unicode string data. Ex: “Hello World”   true false true false string
childPlans A list of data. Ex: [‘abc’, 26.73, 8] [] false false false false list
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
project Unicode string data. Ex: “Hello World” n/a false true true false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
chefInfo A dictionary of data. Ex: {‘price’: 26.73, ‘name’: ‘Daniel’} {} false false false false dict
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
sample Unicode string data. Ex: “Hello World”   true false true false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
barcodedSamples Unicode string data. Ex: “Hello World”   true false true false string
regionfile Unicode string data. Ex: “Hello World”   false false true false string
selectedPlugins Unicode string data. Ex: “Hello World”   true false true false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
libraryKey Unicode string data. Ex: “Hello World”   false false true false string
flows Integer data. Ex: 2673 0 false false false false integer
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
variantfrequency Unicode string data. Ex: “Hello World”   false true false false string
sampleSetDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
flowsInOrder Unicode string data. Ex: “Hello World”   true false true false string
libraryPrepType Unicode string data. Ex: “Hello World”   true true true false string
sampleGrouping A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
chipBarcode Unicode string data. Ex: “Hello World”   false false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
libraryPrepTypeDisplayedName Unicode string data. Ex: “Hello World”   true true true false string
reverse3primeadapter Unicode string data. Ex: “Hello World”   false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 111,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/plannedexperiment/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "planDisplayedName": "Ion AmpliSeq HD for Tumor - DNA",
            "autoAnalyze": true,
            "endBarcodeKitName": "",
            "templatingKitBarcode": null,
            "preAnalysis": true,
            "thumbnailanalysisargs": "Analysis --args-json /opt/ion/config/args_540_analysis.json --thumbnail true",
            "applicationGroup": "/rundb/api/v1/applicationgroup/1/",
            "mixedTypeRNA_hotSpotRegionBedFile": "",
            "mixedTypeRNA_targetRegionBedFile": "",
            "platform": "",
            "categories": "onco_solidTumor;onco_heme;",
            "planPGM": null,
            "prebasecallerargs": "BaseCaller --barcode-filter-minreads 10 --phasing-residual-filter=2.0 --max-phasing-levels 2 --wells-normalization on --read-structure AmpliseqHD --tag-filter-method need-prefix",
            "alignmentargs": "tmap mapall -g 0 ... --context stage1 map4",
            "thumbnailbasecallerargs": "BaseCaller --barcode-filter-minreads 10 --phasing-residual-filter=2.0 --wells-normalization on --read-structure AmpliseqHD",
            "libkit": null,
            "projects": [],
            "notes": "",
            "sequencekitname": "Ion S5 Sequencing Kit",
            "base_recalibration_mode": "standard_recal",
            "storageHost": null,
            "expName": "",
            "thumbnailionstatsargs": "ionstats alignment",
            "cycles": null,
            "isReverseRun": false,
            "storage_options": "A",
            "thumbnailalignmentargs": "tmap mapall -g 0 ... --context stage1 map4",
            "chipType": "540",
            "library": "hg19",
            "runMode": "single",
            "sampleTubeLabel": "",
            "seqKitBarcode": null,
            "barcodeId": "Ion AmpliSeq HD Dual Barcode Kit 1-24",
            "isPlanGroup": false,
            "realign": false,
            "sampleGroupingName": "Self",
            "experiment": "/rundb/api/v1/experiment/136/",
            "bedfile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
            "applicationCategoryDisplayedName": "Oncology - Solid Tumor | Oncology - HemeOnc",
            "isReusable": false,
            "isDuplicateReads": false,
            "sampleSets": [],
            "thumbnailbeadfindargs": "justBeadFind --args-json /opt/ion/config/args_540_beadfind.json --thumbnail true",
            "librarykitname": "Ion AmpliSeq HD Library Kit",
            "sseBedFile": "",
            "adapter": null,
            "basecallerargs": "BaseCaller --barcode-filter-minreads 10 --phasing-residual-filter=2.0 --max-phasing-levels 2 --num-unfiltered 1000 --barcode-filter-postpone 1 --wells-normalization on --read-structure AmpliseqHD",
            "earlyDatFileDeletion": false,
            "parentPlan": null,
            "origin": "gui|5.10.0.RC4",
            "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
            "planStatus": "pending",
            "isCustom_kitSettings": false,
            "samplePrepKitName": null,
            "applicationGroupDisplayedName": "DNA",
            "metaData": {
                "fromTemplate": "Ion_AmpliSeq_HD_for_Tumor_-_DNA",
                "fromTemplateSource": "ION"
            },
            "isFavorite": false,
            "qcValues": [
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/143/",
                    "id": 407,
                    "qcType": {
                        "description": "",
                        "minThreshold": 1,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Key Signal (1-100)",
                        "id": 2,
                        "resource_uri": "/rundb/api/v1/qctype/2/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/407/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/143/",
                    "id": 408,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Usable Sequence (%)",
                        "id": 3,
                        "resource_uri": "/rundb/api/v1/qctype/3/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/408/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/143/",
                    "id": 406,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Bead Loading (%)",
                        "id": 1,
                        "resource_uri": "/rundb/api/v1/qctype/1/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/406/"
                }
            ],
            "analysisargs": "Analysis --args-json /opt/ion/config/args_540_analysis.json",
            "thumbnailcalibrateargs": "Calibration",
            "templatingKitName": "Ion Chef S540 V1",
            "runType": "AMPS_HD_DNA",
            "username": "ionadmin",
            "planShortID": "SP1XE",
            "sampleDisplayedName": "",
            "prethumbnailbasecallerargs": "BaseCaller --barcode-filter-minreads 10 --phasing-residual-filter=2.0 --wells-normalization on --read-structure AmpliseqHD --tag-filter-method need-prefix",
            "controlSequencekitname": null,
            "tfKey": "ATCG",
            "mixedTypeRNA_reference": "",
            "childPlans": [],
            "pairedEndLibraryAdapterName": "",
            "reverselibrarykey": "",
            "irworkflow": "",
            "planExecuted": false,
            "project": "",
            "usePostBeadfind": false,
            "libraryReadLength": 200,
            "runname": null,
            "chefInfo": {},
            "planGUID": "1d75abf5-4d15-43f5-bb08-1c89d7344175",
            "ionstatsargs": "ionstats alignment",
            "samplePrepProtocol": "",
            "sample": "",
            "planExecutedDate": null,
            "reverse_primer": null,
            "id": 143,
            "barcodedSamples": {
                "Sample 10": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0110": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0110"
                    ]
                },
                "Sample 8": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0108": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0108"
                    ]
                },
                "Sample 9": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0109": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0109"
                    ]
                },
                "Sample 6": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0106": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0106"
                    ]
                },
                "Sample 7": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0107": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0107"
                    ]
                },
                "Sample 4": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0104": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0104"
                    ]
                },
                "Sample 5": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0105": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0105"
                    ]
                },
                "Sample 2": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0102": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0102"
                    ]
                },
                "Sample 3": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0103": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0103"
                    ]
                },
                "Sample 1": {
                    "dualBarcodes": [],
                    "barcodeSampleInfo": {
                        "IonHDdual_0101": {
                            "description": "",
                            "reference": "hg19",
                            "targetRegionBedFile": "/results/uploads/BED/2/hg19/unmerged/detail/AmpliSeqExome.20141113.designed.bed",
                            "hotSpotRegionBedFile": "",
                            "nucleotideType": "DNA",
                            "controlSequenceType": "",
                            "externalId": "",
                            "endBarcode": "",
                            "controlType": "",
                            "sseBedFile": ""
                        }
                    },
                    "barcodes": [
                        "IonHDdual_0101"
                    ]
                }
            },
            "custom_args": false,
            "regionfile": "",
            "selectedPlugins": {
                "coverageAnalysis": {
                    "userInput": {},
                    "version": "5.8.0.8",
                    "features": [],
                    "name": "coverageAnalysis",
                    "id": 41
                },
                "variantCaller": {
                    "userInput": {
                        "meta": {
                            "configuration": "ampliseq_hd_ffpe"
                        }
                    },
                    "version": "5.8.0.19",
                    "features": [],
                    "name": "variantCaller",
                    "id": 36
                }
            },
            "beadfindargs": "justBeadFind --args-json /opt/ion/config/args_540_beadfind.json",
            "isSystemDefault": false,
            "autoName": null,
            "libraryKey": "TCAG",
            "flows": 500,
            "date": "2018-04-13T22:17:13.000108+00:00",
            "isSystem": false,
            "variantfrequency": "",
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA",
            "calibrateargs": "Calibration",
            "flowsInOrder": "",
            "libraryPrepType": "",
            "sampleGrouping": "/rundb/api/v1/samplegrouptype_cv/2/",
            "chipBarcode": "",
            "sampleSetDisplayedName": "",
            "usePreBeadfind": true,
            "resource_uri": "/rundb/api/v1/plannedexperiment/143/",
            "libraryPrepTypeDisplayedName": "",
            "reverse3primeadapter": ""
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Planned Experiment Db Resource

Resource URL http://mytorrentserver/rundb/api/v1/plannedexperimentdb/
Schema URL http://mytorrentserver/rundb/api/v1/plannedexperimentdb/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
username Unicode string data. Ex: “Hello World” n/a true false false false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
isFavorite Boolean data. Ex: True false false false true false boolean
qcValues Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
parentPlan Unicode string data. Ex: “Hello World” None false false true false string
childPlans A list of data. Ex: [‘abc’, 26.73, 8] [] false false false false list
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
sampleGrouping A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
project Unicode string data. Ex: “Hello World” n/a false true true false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 111,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/plannedexperimentdb/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "origin": "gui|5.10.0.RC4",
            "isReverseRun": false,
            "planDisplayedName": "Ion AmpliSeq HD for Tumor - DNA",
            "storage_options": "A",
            "preAnalysis": true,
            "planShortID": "SP1XE",
            "username": "ionadmin",
            "planStatus": "pending",
            "runMode": "single",
            "isCustom_kitSettings": false,
            "sampleTubeLabel": "",
            "planExecutedDate": null,
            "samplePrepKitName": null,
            "reverse_primer": null,
            "applicationGroup": "/rundb/api/v1/applicationgroup/1/",
            "seqKitBarcode": null,
            "id": 143,
            "metaData": {
                "fromTemplate": "Ion_AmpliSeq_HD_for_Tumor_-_DNA",
                "fromTemplateSource": "ION"
            },
            "sampleSets": [],
            "isFavorite": false,
            "qcValues": [
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/143/",
                    "id": 407,
                    "qcType": {
                        "description": "",
                        "minThreshold": 1,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Key Signal (1-100)",
                        "id": 2,
                        "resource_uri": "/rundb/api/v1/qctype/2/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/407/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/143/",
                    "id": 408,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Usable Sequence (%)",
                        "id": 3,
                        "resource_uri": "/rundb/api/v1/qctype/3/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/408/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/143/",
                    "id": 406,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Bead Loading (%)",
                        "id": 1,
                        "resource_uri": "/rundb/api/v1/qctype/1/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/406/"
                }
            ],
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "experiment": "/rundb/api/v1/experiment/136/",
            "projects": [],
            "runType": "AMPS_HD_DNA",
            "templatingKitBarcode": null,
            "templatingKitName": "Ion Chef S540 V1",
            "planPGM": null,
            "isSystemDefault": false,
            "autoName": null,
            "isReusable": false,
            "controlSequencekitname": null,
            "date": "2018-04-13T22:17:13.000108+00:00",
            "isSystem": false,
            "libkit": null,
            "categories": "onco_solidTumor;onco_heme;",
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA",
            "parentPlan": null,
            "childPlans": [],
            "pairedEndLibraryAdapterName": "",
            "sampleGrouping": "/rundb/api/v1/samplegrouptype_cv/2/",
            "adapter": null,
            "irworkflow": "",
            "planExecuted": false,
            "project": "",
            "usePostBeadfind": false,
            "storageHost": null,
            "expName": "",
            "libraryReadLength": 200,
            "runname": null,
            "usePreBeadfind": true,
            "planGUID": "1d75abf5-4d15-43f5-bb08-1c89d7344175",
            "cycles": null,
            "resource_uri": "/rundb/api/v1/plannedexperimentdb/143/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Planned Experiment Qc Resource

Resource URL http://mytorrentserver/rundb/api/v1/plannedexperimentqc/
Schema URL http://mytorrentserver/rundb/api/v1/plannedexperimentqc/schema/

Resource Fields
field help text default nullable readonly blank unique type
threshold Integer data. Ex: 2673 0 false false false false integer
plannedExperiment A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
id Integer data. Ex: 2673   false false true true integer
qcType A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 318,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/plannedexperimentqc/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "threshold": 30,
            "plannedExperiment": "/rundb/api/v1/plannedexperiment/43/",
            "id": 127,
            "qcType": {
                "description": "",
                "minThreshold": 0,
                "maxThreshold": 100,
                "defaultThreshold": 30,
                "qcName": "Bead Loading (%)",
                "id": 1,
                "resource_uri": "/rundb/api/v1/qctype/1/"
            },
            "resource_uri": "/rundb/api/v1/plannedexperimentqc/127/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Plan Template Basic Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/plantemplatebasicinfo/
Schema URL http://mytorrentserver/rundb/api/v1/plantemplatebasicinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
reference Unicode string data. Ex: “Hello World” n/a true true true false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
hotSpotRegionBedFile Unicode string data. Ex: “Hello World”   true true true false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
applicationGroupDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
sampleGroupName Unicode string data. Ex: “Hello World” n/a true true true false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
barcodeKitName Unicode string data. Ex: “Hello World” n/a true true true false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
applicationCategoryDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
sequencingInstrumentType Unicode string data. Ex: “Hello World” n/a true true true false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
eas A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
irAccountName Unicode string data. Ex: “Hello World” n/a true true true false string
templatePrepInstrumentType Unicode string data. Ex: “Hello World” n/a true true true false string
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
targetRegionBedFile Unicode string data. Ex: “Hello World”   true true true false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
username Unicode string data. Ex: “Hello World” n/a true false false false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
notes Unicode string data. Ex: “Hello World”   true true true false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 96,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/plantemplatebasicinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "origin": "|5.10.0.RC4",
            "isReverseRun": false,
            "planDisplayedName": "Ion AmpliSeq HD for Tumor - DNA and Fusions - Separate Libraries",
            "storage_options": "A",
            "preAnalysis": true,
            "reference": "hg19",
            "planShortID": "A628Z",
            "hotSpotRegionBedFile": "",
            "planStatus": "planned",
            "runMode": "single",
            "isCustom_kitSettings": false,
            "sampleTubeLabel": null,
            "planExecutedDate": null,
            "samplePrepKitName": null,
            "reverse_primer": null,
            "applicationGroup": "/rundb/api/v1/applicationgroup/5/",
            "applicationGroupDisplayedName": "DNA and Fusions (Separate Libraries)",
            "id": 141,
            "metaData": {},
            "isFavorite": false,
            "seqKitBarcode": null,
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "sampleGroupName": "DNA and Fusions",
            "experiment": "/rundb/api/v1/experiment/134/",
            "projects": "",
            "barcodeKitName": "Ion AmpliSeq HD Dual Barcode Kit 1-24",
            "runType": "AMPS_HD_DNA_RNA",
            "templatingKitBarcode": null,
            "templatingKitName": "Ion Chef S540 V1",
            "planPGM": "",
            "isSystemDefault": false,
            "applicationCategoryDisplayedName": "Oncology - Solid Tumor | Oncology - HemeOnc",
            "autoName": null,
            "isReusable": true,
            "controlSequencekitname": null,
            "sequencingInstrumentType": "s5",
            "date": "2018-04-12T05:54:10.000222+00:00",
            "eas": "/rundb/api/v1/experimentanalysissettings/133/",
            "isSystem": true,
            "libkit": null,
            "categories": "onco_solidTumor;onco_heme;",
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA_and_Fusions_-_Separate_Libraries",
            "irAccountName": "",
            "templatePrepInstrumentType": "IonChef",
            "pairedEndLibraryAdapterName": null,
            "targetRegionBedFile": "",
            "adapter": null,
            "irworkflow": "",
            "planExecuted": false,
            "username": null,
            "usePostBeadfind": false,
            "storageHost": null,
            "expName": "",
            "libraryReadLength": 200,
            "runname": null,
            "usePreBeadfind": true,
            "planGUID": "e52fac66-4086-433e-b8e7-ad1d1403946f",
            "cycles": null,
            "notes": "",
            "resource_uri": "/rundb/api/v1/plantemplatebasicinfo/141/"
        }
    ]
}
Allowed list HTTP methods
  • GET
Allowed detail HTTP methods
  • GET

Plan Template Summary Resource

Resource URL http://mytorrentserver/rundb/api/v1/plantemplatesummary/
Schema URL http://mytorrentserver/rundb/api/v1/plantemplatesummary/schema/

Resource Fields
field help text default nullable readonly blank unique type
origin Unicode string data. Ex: “Hello World”   true false false false string
isReverseRun Boolean data. Ex: True false false false true false boolean
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
storage_options Unicode string data. Ex: “Hello World” A false false false false string
preAnalysis Boolean data. Ex: True true false false true false boolean
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
planStatus Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
isCustom_kitSettings Boolean data. Ex: True false false false true false boolean
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
isFavorite Boolean data. Ex: True false false false true false boolean
samplePrepProtocol Unicode string data. Ex: “Hello World”   true false false false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
isReusable Boolean data. Ex: True false false false true false boolean
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
username Unicode string data. Ex: “Hello World” n/a true false false false string
usePostBeadfind Boolean data. Ex: True true false false true false boolean
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True true false false true false boolean
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
cycles Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 103,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/plantemplatesummary/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "origin": "|5.10.0.RC4",
            "isReverseRun": false,
            "planDisplayedName": "Ion AmpliSeq HD for Tumor - DNA and Fusions - Separate Libraries",
            "storage_options": "A",
            "preAnalysis": true,
            "planShortID": "A628Z",
            "planStatus": "planned",
            "runMode": "single",
            "isCustom_kitSettings": false,
            "sampleTubeLabel": null,
            "planExecutedDate": null,
            "samplePrepKitName": null,
            "reverse_primer": null,
            "seqKitBarcode": null,
            "id": 141,
            "metaData": {},
            "isFavorite": false,
            "samplePrepProtocol": "",
            "isPlanGroup": false,
            "templatingKitName": "Ion Chef S540 V1",
            "runType": "AMPS_HD_DNA_RNA",
            "templatingKitBarcode": null,
            "planPGM": "",
            "isSystemDefault": false,
            "autoName": null,
            "isReusable": true,
            "controlSequencekitname": null,
            "date": "2018-04-12T05:54:10.000222+00:00",
            "isSystem": true,
            "libkit": null,
            "categories": "onco_solidTumor;onco_heme;",
            "planName": "Ion_AmpliSeq_HD_for_Tumor_-_DNA_and_Fusions_-_Separate_Libraries",
            "pairedEndLibraryAdapterName": null,
            "adapter": null,
            "irworkflow": "",
            "planExecuted": false,
            "username": null,
            "usePostBeadfind": false,
            "storageHost": null,
            "expName": "",
            "libraryReadLength": 200,
            "runname": null,
            "usePreBeadfind": true,
            "planGUID": "e52fac66-4086-433e-b8e7-ad1d1403946f",
            "cycles": null,
            "resource_uri": "/rundb/api/v1/plantemplatesummary/141/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Plugin Resource

Resource URL http://mytorrentserver/rundb/api/v1/plugin/
Schema URL http://mytorrentserver/rundb/api/v1/plugin/schema/

Resource Fields
field help text default nullable readonly blank unique type
active Boolean data. Ex: True true false false true false boolean
availableVersions A list of data. Ex: [‘abc’, 26.73, 8] [] false true false false list
id Integer data. Ex: 2673   false false true true integer
isPlanConfig Boolean data. Ex: True n/a false true false false boolean
isSupported Boolean data. Ex: True n/a false true false false boolean
script Unicode string data. Ex: “Hello World”   false false true false string
selected Boolean data. Ex: True false false false true false boolean
requires_configuration Boolean data. Ex: True false false false true false boolean
version Unicode string data. Ex: “Hello World” n/a false false false false string
hasAbout Boolean data. Ex: True n/a false true false false boolean
input Unicode string data. Ex: “Hello World” n/a false true false false string
majorBlock Boolean data. Ex: True false false false true false boolean
status Unicode string data. Ex: “Hello World”   true false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
defaultSelected Boolean data. Ex: True false false false true false boolean
pluginsettings Unicode string data. Ex: “Hello World”   true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
path Unicode string data. Ex: “Hello World”   false false true false string
isConfig Boolean data. Ex: True n/a false true false false boolean
isInstance Boolean data. Ex: True n/a false true false false boolean
name Unicode string data. Ex: “Hello World” n/a false false false false string
userinputfields Unicode string data. Ex: “Hello World” {} true false false false string
url Unicode string data. Ex: “Hello World”   false false true false string
config Unicode string data. Ex: “Hello World”   true false false false string
packageName Unicode string data. Ex: “Hello World”   false false true false string
versionedName Unicode string data. Ex: “Hello World” n/a false true false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
isUpgradable Boolean data. Ex: True false false true false false boolean
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 16,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/plugin/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "active": true,
            "availableVersions": [
                "5.8.0.0"
            ],
            "id": 30,
            "isPlanConfig": true,
            "isSupported": true,
            "script": "smallRNA.py",
            "selected": true,
            "requires_configuration": false,
            "version": "5.8.0.0",
            "hasAbout": false,
            "input": "/configure/plugins/plugin/30/configure/report/",
            "majorBlock": true,
            "status": {},
            "description": "Run the small RNA pipeline.",
            "defaultSelected": false,
            "pluginsettings": {
                "depends": [],
                "features": [],
                "runtypes": [
                    "wholechip",
                    "thumbnail",
                    "composite"
                ],
                "runlevels": [
                    "default"
                ]
            },
            "date": "2017-12-05T00:11:04.000271+00:00",
            "path": "/results/plugins/smallRNA",
            "isConfig": true,
            "isInstance": true,
            "name": "smallRNA",
            "userinputfields": {},
            "url": "",
            "config": {},
            "packageName": "ion-plugin-smallrna",
            "versionedName": "smallRNA--v5.8.0.0",
            "resource_uri": "/rundb/api/v1/plugin/30/",
            "isUpgradable": false
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Plugin Result Resource

Resource URL http://mytorrentserver/rundb/api/v1/pluginresult/
Schema URL http://mytorrentserver/rundb/api/v1/pluginresult/schema/

Resource Fields
field help text default nullable readonly blank unique type
major Boolean data. Ex: True n/a false true false false boolean
can_terminate Boolean data. Ex: True n/a false true false false boolean
resultName Unicode string data. Ex: “Hello World” n/a false true false false string
pluginVersion Unicode string data. Ex: “Hello World” n/a false true false false string
result A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
owner A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
id Integer data. Ex: 2673   false false true true integer
size Unicode string data. Ex: “Hello World” -1 false false false false string
validation_errors Unicode string data. Ex: “Hello World” {} false false true false string
state Unicode string data. Ex: “Hello World” n/a false true false false string
store Unicode string data. Ex: “Hello World” {} false false true false string
files A list of data. Ex: [‘abc’, 26.73, 8] n/a false true false false list
URL Unicode string data. Ex: “Hello World” n/a false true false false string
plugin_result_jobs Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
path Unicode string data. Ex: “Hello World” n/a false true false false string
endtime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a false true false false datetime
apikey Unicode string data. Ex: “Hello World” n/a true false false false string
plugin A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
reportLink Unicode string data. Ex: “Hello World” n/a false true false false string
pluginName Unicode string data. Ex: “Hello World” n/a false true false false string
starttime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a false true false false datetime
inodes Unicode string data. Ex: “Hello World” -1 false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 17,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/pluginresult/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "major": true,
            "can_terminate": false,
            "resultName": "Auto_user_CB1-42-r9723-314wfa-tl_94",
            "pluginVersion": "5.8.0.0",
            "result": "/rundb/api/v1/results/6/",
            "owner": "/rundb/api/v1/user/2/",
            "id": 24,
            "size": "344884433",
            "validation_errors": {
                "validation_errors": []
            },
            "state": "Error",
            "store": {
                "reference": "/results/referenceLibrary/tmap-f3/hg19/hg19.fasta",
                "barcoded": false,
                "Error": "Failed running run_rnaseqanalysis.py.",
                "genome": "hg19",
                "launch_mode": "Manual",
                "fpkm_thres": "0.3",
                "cutadapt": "None",
                "fraction_of_reads": "1"
            },
            "files": [
                "RNASeqAnalysis.html"
            ],
            "URL": "/output/Home/Auto_user_CB1-42-r9723-314wfa-tl_94_006/plugin_out/RNASeqAnalysis_out.24/",
            "plugin_result_jobs": [
                {
                    "grid_engine_jobid": 517,
                    "id": 24,
                    "state": "Error",
                    "starttime": "2018-04-25T22:22:52.000576+00:00",
                    "endtime": "2018-04-25T22:28:47.000816+00:00",
                    "config": {
                        "cutadapt": "None",
                        "fraction_of_reads": "1",
                        "reference": "/results/referenceLibrary/tmap-f3/hg19/hg19.fasta",
                        "genome": "hg19",
                        "launch_mode": "Manual"
                    },
                    "run_level": "default",
                    "resource_uri": "/rundb/api/v1/PluginResultJob/24/"
                }
            ],
            "path": "/results/analysis/output/Home/Auto_user_CB1-42-r9723-314wfa-tl_94_006/plugin_out/RNASeqAnalysis_out.24",
            "endtime": "2018-04-25T22:28:47.000816+00:00",
            "apikey": "5a4f5fb12ef3d6c5490b3a41501097a506cd8d85",
            "plugin": "/rundb/api/v1/plugin/29/",
            "reportLink": "/output/Home/Auto_user_CB1-42-r9723-314wfa-tl_94_006/",
            "pluginName": "RNASeqAnalysis",
            "starttime": "2018-04-25T22:22:52.000576+00:00",
            "inodes": "33",
            "resource_uri": "/rundb/api/v1/pluginresult/24/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Plugin Result Job Resource

Resource URL http://mytorrentserver/rundb/api/v1/PluginResultJob/
Schema URL http://mytorrentserver/rundb/api/v1/PluginResultJob/schema/

Resource Fields
field help text default nullable readonly blank unique type
grid_engine_jobid Integer data. Ex: 2673 n/a true false false false integer
id Integer data. Ex: 2673   false false true true integer
state Unicode string data. Ex: “Hello World” n/a false false false false string
starttime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
endtime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
config Unicode string data. Ex: “Hello World”   false false true false string
run_level Unicode string data. Ex: “Hello World” n/a false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 17,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/PluginResultJob/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "grid_engine_jobid": -1,
            "id": 19,
            "state": "Completed",
            "starttime": "2017-08-09T20:26:03.000549+00:00",
            "endtime": "2017-08-09T20:30:11.000942+00:00",
            "config": {
                "compressedType": "zip",
                "bamCreate": "on",
                "xlsCreate": "off",
                "zipFASTQ": "off",
                "vcfCreate": "on",
                "zipXLS": "off",
                "delimiter_select": ".",
                "zipVCF": "on",
                "zipBAM": "on",
                "fastqCreate": "off",
                "select_dialog": [
                    "run_name",
                    "samplename",
                    "instrument",
                    "",
                    "",
                    "",
                    ""
                ]
            },
            "run_level": "last",
            "resource_uri": "/rundb/api/v1/PluginResultJob/19/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Project Resource

Resource URL http://mytorrentserver/rundb/api/v1/project/
Schema URL http://mytorrentserver/rundb/api/v1/project/schema/

Resource Fields
field help text default nullable readonly blank unique type
name Unicode string data. Ex: “Hello World” n/a false false false true string
creator A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
created A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
modified A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
id Integer data. Ex: 2673   false false true true integer
resultsCount Integer data. Ex: 2673 n/a false true false false integer
public Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/project/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "name": "demo",
            "creator": "/rundb/api/v1/user/1/",
            "created": "2017-07-22T06:59:07.000475+00:00",
            "modified": "2018-02-28T17:32:01.000703+00:00",
            "id": 1,
            "resultsCount": 6,
            "public": true,
            "resource_uri": "/rundb/api/v1/project/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Project Results Resource

Resource URL http://mytorrentserver/rundb/api/v1/projectresults/
Schema URL http://mytorrentserver/rundb/api/v1/projectresults/schema/

Resource Fields
field help text default nullable readonly blank unique type
reference Unicode string data. Ex: “Hello World” n/a true false false false string
reportStatus Unicode string data. Ex: “Hello World” Nothing true false false false string
runid Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
metaData Unicode string data. Ex: “Hello World” {} false false true false string
log Unicode string data. Ex: “Hello World”   false false true false string
timeStamp A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
resultsName Unicode string data. Ex: “Hello World” n/a false false false false string
status Unicode string data. Ex: “Hello World” n/a false false false false string
processedflows Integer data. Ex: 2673 n/a false false false false integer
processedCycles Integer data. Ex: 2673 n/a false false false false integer
representative Boolean data. Ex: True false false false true false boolean
diskusage Integer data. Ex: 2673 n/a true false false false integer
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
resultsType Unicode string data. Ex: “Hello World”   false false true false string
parentIDs Unicode string data. Ex: “Hello World”   false false true false string
timeToComplete Unicode string data. Ex: “Hello World” n/a false false false false string
reportLink Unicode string data. Ex: “Hello World” n/a false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
framesProcessed Integer data. Ex: 2673 n/a false false false false integer
autoExempt Boolean data. Ex: True false false false true false boolean
analysisVersion Unicode string data. Ex: “Hello World” n/a false false false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 7,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/projectresults/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "reference": "",
            "reportStatus": "Nothing",
            "runid": "MJMQ3",
            "id": 3,
            "metaData": {},
            "log": "/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003/log.html",
            "timeStamp": "2017-07-22T13:15:56.000197+00:00",
            "resultsName": "Auto_S5-540_WholeTranscriptomeRNA_91",
            "status": "Completed",
            "processedflows": 0,
            "processedCycles": 0,
            "representative": false,
            "diskusage": 229301,
            "projects": [
                "/rundb/api/v1/project/1/"
            ],
            "resultsType": "",
            "parentIDs": "",
            "timeToComplete": "0",
            "reportLink": "/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003/",
            "resource_uri": "/rundb/api/v1/projectresults/3/",
            "framesProcessed": 0,
            "autoExempt": false,
            "analysisVersion": "db:5.6.18-1,an:5.6.5-1,"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Publisher Resource

Resource URL http://mytorrentserver/rundb/api/v1/publisher/
Schema URL http://mytorrentserver/rundb/api/v1/publisher/schema/

Resource Fields
field help text default nullable readonly blank unique type
name Unicode string data. Ex: “Hello World” n/a false false false true string
version Unicode string data. Ex: “Hello World” n/a false false false false string
global_meta Unicode string data. Ex: “Hello World” {} false false true false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a false false false false datetime
path Unicode string data. Ex: “Hello World” n/a false false false false string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/publisher/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "name": "BED",
            "version": "1.0",
            "global_meta": {},
            "date": "2017-07-22T21:17:13.000054+00:00",
            "path": "/results/publishers/BED",
            "id": 2,
            "resource_uri": "/rundb/api/v1/publisher/BED/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Qc Type Resource

Resource URL http://mytorrentserver/rundb/api/v1/qctype/
Schema URL http://mytorrentserver/rundb/api/v1/qctype/schema/

Resource Fields
field help text default nullable readonly blank unique type
description Unicode string data. Ex: “Hello World”   false false true false string
minThreshold Integer data. Ex: 2673 0 false false false false integer
maxThreshold Integer data. Ex: 2673 100 false false false false integer
defaultThreshold Integer data. Ex: 2673 0 false false false false integer
qcName Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 3,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/qctype/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "description": "",
            "minThreshold": 0,
            "maxThreshold": 100,
            "defaultThreshold": 30,
            "qcName": "Bead Loading (%)",
            "id": 1,
            "resource_uri": "/rundb/api/v1/qctype/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Quality Metrics Resource

Resource URL http://mytorrentserver/rundb/api/v1/qualitymetrics/
Schema URL http://mytorrentserver/rundb/api/v1/qualitymetrics/schema/

Resource Fields
field help text default nullable readonly blank unique type
q0_reads Integer data. Ex: 2673 n/a false false false false integer
q17_max_read_length Integer data. Ex: 2673 n/a false false false false integer
q20_median_read_length Integer data. Ex: 2673 0 false false false false integer
q20_reads Integer data. Ex: 2673 n/a false false false false integer
report A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
q17_mean_read_length Floating point numeric data. Ex: 26.73 n/a false false false false float
q17_100bp_reads Integer data. Ex: 2673 n/a false false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
q0_max_read_length Integer data. Ex: 2673 n/a false false false false integer
q20_100bp_reads Integer data. Ex: 2673 n/a false false false false integer
id Integer data. Ex: 2673   false false true true integer
q20_mean_read_length Integer data. Ex: 2673 n/a false false false false integer
q20_150bp_reads Integer data. Ex: 2673 n/a false false false false integer
q0_bases Unicode string data. Ex: “Hello World” n/a false false false false string
q20_50bp_reads Integer data. Ex: 2673 n/a false false false false integer
q17_reads Integer data. Ex: 2673 n/a false false false false integer
q17_50bp_reads Integer data. Ex: 2673 n/a false false false false integer
q17_median_read_length Integer data. Ex: 2673 0 false false false false integer
q0_50bp_reads Integer data. Ex: 2673 n/a false false false false integer
q17_150bp_reads Integer data. Ex: 2673 n/a false false false false integer
q0_150bp_reads Integer data. Ex: 2673 0 false false false false integer
q0_mean_read_length Floating point numeric data. Ex: 26.73 n/a false false false false float
q17_bases Unicode string data. Ex: “Hello World” n/a false false false false string
q0_mode_read_length Integer data. Ex: 2673 0 false false false false integer
q20_mode_read_length Integer data. Ex: 2673 0 false false false false integer
q20_max_read_length Floating point numeric data. Ex: 26.73 n/a false false false false float
q20_bases Unicode string data. Ex: “Hello World” n/a false false false false string
q0_median_read_length Integer data. Ex: 2673 0 false false false false integer
q0_100bp_reads Integer data. Ex: 2673 n/a false false false false integer
q17_mode_read_length Integer data. Ex: 2673 0 false false false false integer
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 6,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/qualitymetrics/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "q0_reads": 93969124,
            "q17_max_read_length": 361,
            "q20_median_read_length": 149,
            "q20_reads": 93969124,
            "report": "/rundb/api/v1/results/3/",
            "q17_mean_read_length": 149.579903660696,
            "q17_100bp_reads": 82389255,
            "resource_uri": "/rundb/api/v1/qualitymetrics/1/",
            "q0_max_read_length": 361,
            "q20_100bp_reads": 82389255,
            "id": 1,
            "q20_mean_read_length": 149,
            "q20_150bp_reads": 46834701,
            "q0_bases": "14055892515",
            "q20_50bp_reads": 91801424,
            "q17_reads": 93969124,
            "q17_50bp_reads": 91801424,
            "q17_median_read_length": 149,
            "q0_50bp_reads": 91801424,
            "q17_150bp_reads": 46834701,
            "q0_150bp_reads": 46834701,
            "q0_mean_read_length": 149.579903660696,
            "q17_bases": "12627160533",
            "q0_mode_read_length": 141,
            "q20_mode_read_length": 141,
            "q20_max_read_length": 361,
            "q20_bases": "11916010889",
            "q0_median_read_length": 149,
            "q0_100bp_reads": 82389255,
            "q17_mode_read_length": 141
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Reference Genome Resource

Resource URL http://mytorrentserver/rundb/api/v1/referencegenome/
Schema URL http://mytorrentserver/rundb/api/v1/referencegenome/schema/

Resource Fields
field help text default nullable readonly blank unique type
status Unicode string data. Ex: “Hello World”   false false true false string
reference_path Unicode string data. Ex: “Hello World”   false false true false string
name Unicode string data. Ex: “Hello World” n/a false false false false string
short_name Unicode string data. Ex: “Hello World” n/a false false false false string
index_version Unicode string data. Ex: “Hello World”   false false true false string
notes Unicode string data. Ex: “Hello World”   false false true false string
enabled Boolean data. Ex: True true false false true false boolean
species Unicode string data. Ex: “Hello World”   false false true false string
identity_hash Unicode string data. Ex: “Hello World” None true false false false string
source Unicode string data. Ex: “Hello World”   false false true false string
version Unicode string data. Ex: “Hello World”   false false true false string
celery_task_id Unicode string data. Ex: “Hello World”   false false true false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” 2018-06-19T20:40:12.000844+00:00 false false false false datetime
verbose_error Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 6,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/referencegenome/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "status": "complete",
            "reference_path": "/results/referenceLibrary/tmap-f3/AmpliSeq_Mouse_Transcriptome_v1",
            "name": "AmpliSeq Mouse Transcriptome v1",
            "short_name": "AmpliSeq_Mouse_Transcriptome_v1",
            "index_version": "tmap-f3",
            "notes": "",
            "enabled": true,
            "species": "",
            "identity_hash": "92e672f416392e46e3137388d878efe7",
            "source": "http://ionupdates.com/reference_downloads/AmpliSeq_Mouse_Transcriptome_v1.zip",
            "version": "",
            "celery_task_id": "370dd08d-d9d0-4f9f-8965-d0563a4461b7",
            "date": "2018-01-23T22:42:16.000613+00:00",
            "verbose_error": "",
            "id": 4,
            "resource_uri": "/rundb/api/v1/referencegenome/4/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Results Resource

Resource URL http://mytorrentserver/rundb/api/v1/results/
Schema URL http://mytorrentserver/rundb/api/v1/results/schema/

Resource Fields
field help text default nullable readonly blank unique type
reference Unicode string data. Ex: “Hello World” n/a true false false false string
processedflows Integer data. Ex: 2673 n/a false false false false integer
reportStatus Unicode string data. Ex: “Hello World” Nothing true false false false string
reportstorage A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
analysisVersion Unicode string data. Ex: “Hello World” n/a false false false false string
runid Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
filesystempath Unicode string data. Ex: “Hello World” n/a false false false false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
log Unicode string data. Ex: “Hello World”   false false true false string
timeStamp A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
libmetrics Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
resultsName Unicode string data. Ex: “Hello World” n/a false false false false string
status Unicode string data. Ex: “Hello World” n/a false false false false string
planShortID Unicode string data. Ex: “Hello World” n/a false false false false string
processedCycles Integer data. Ex: 2673 n/a false false false false integer
bamLink Unicode string data. Ex: “Hello World” n/a false false false false string
representative Boolean data. Ex: True false false false true false boolean
pluginState A dictionary of data. Ex: {‘price’: 26.73, ‘name’: ‘Daniel’} n/a false true false false dict
qualitymetrics Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
diskusage Integer data. Ex: 2673 n/a true false false false integer
eas A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
pluginStore A dictionary of data. Ex: {‘price’: 26.73, ‘name’: ‘Daniel’} n/a false true false false dict
resultsType Unicode string data. Ex: “Hello World”   false false true false string
tfmetrics Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
parentIDs Unicode string data. Ex: “Hello World”   false false true false string
analysismetrics Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
timeToComplete Unicode string data. Ex: “Hello World” n/a false false false false string
reportLink Unicode string data. Ex: “Hello World” n/a false false false false string
pluginresults Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
framesProcessed Integer data. Ex: 2673 n/a false false false false integer
autoExempt Boolean data. Ex: True false false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 7,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/results/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "reference": "",
            "processedflows": 0,
            "reportStatus": "Nothing",
            "reportstorage": {
                "name": "Home",
                "default": true,
                "webServerPath": "/output",
                "dirPath": "/results/analysis/output",
                "id": 1,
                "resource_uri": ""
            },
            "analysisVersion": "db:5.6.18-1,an:5.6.5-1,",
            "runid": "MJMQ3",
            "id": 3,
            "filesystempath": "/results/analysis/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003",
            "metaData": {},
            "log": "/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003/log.html",
            "timeStamp": "2017-07-22T13:15:56.000197+00:00",
            "libmetrics": [
                "/rundb/api/v1/libmetrics/1/"
            ],
            "experiment": "/rundb/api/v1/experiment/91/",
            "resultsName": "Auto_S5-540_WholeTranscriptomeRNA_91",
            "status": "Completed",
            "planShortID": "RI63N",
            "processedCycles": 0,
            "bamLink": "/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003/download_links/S5-540_WholeTranscriptomeRNA_Auto_S5-540_WholeTranscriptomeRNA_91.bam",
            "representative": false,
            "qualitymetrics": [
                "/rundb/api/v1/qualitymetrics/1/"
            ],
            "diskusage": 229301,
            "eas": "/rundb/api/v1/experimentanalysissettings/90/",
            "projects": [
                "/rundb/api/v1/project/1/"
            ],
            "resultsType": "",
            "tfmetrics": [
                "/rundb/api/v1/tfmetrics/2/",
                "/rundb/api/v1/tfmetrics/1/"
            ],
            "parentIDs": "",
            "analysismetrics": [
                "/rundb/api/v1/analysismetrics/1/"
            ],
            "timeToComplete": "0",
            "reportLink": "/output/Home/Auto_S5-540_WholeTranscriptomeRNA_91_003/",
            "pluginresults": [
                "/rundb/api/v1/pluginresult/9/",
                "/rundb/api/v1/pluginresult/8/",
                "/rundb/api/v1/pluginresult/3/"
            ],
            "framesProcessed": 0,
            "autoExempt": false,
            "resource_uri": "/rundb/api/v1/results/3/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Rig Resource

Resource URL http://mytorrentserver/rundb/api/v1/rig/
Schema URL http://mytorrentserver/rundb/api/v1/rig/schema/

Resource Fields
field help text default nullable readonly blank unique type
display_state Unicode string data. Ex: “Hello World”   false false true false string
name Unicode string data. Ex: “Hello World” n/a false false false true string
state Unicode string data. Ex: “Hello World”   false false true false string
version Unicode string data. Ex: “Hello World” {} false false true false string
ftprootdir Unicode string data. Ex: “Hello World” results false false false false string
last_clean_date Unicode string data. Ex: “Hello World”   false false true false string
updatehome Unicode string data. Ex: “Hello World” 192.168.201.1 false false false false string
ftpserver Unicode string data. Ex: “Hello World” 192.168.201.1 false false false false string
comments Unicode string data. Ex: “Hello World”   false false true false string
last_experiment Unicode string data. Ex: “Hello World”   false false true false string
ftppassword Unicode string data. Ex: “Hello World” ionguest false false false false string
updateflag Boolean data. Ex: True false false false true false boolean
location A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
last_init_date Unicode string data. Ex: “Hello World”   false false true false string
updateCommand Unicode string data. Ex: “Hello World” {} false false true false string
alarms Unicode string data. Ex: “Hello World” {} false false true false string
serial Unicode string data. Ex: “Hello World” n/a true false false false string
host_address Unicode string data. Ex: “Hello World”   false false true false string
type Unicode string data. Ex: “Hello World”   false false true false string
ftpusername Unicode string data. Ex: “Hello World” ionguest false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 4,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/rig/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "display_state": "",
            "name": "default",
            "state": "",
            "version": {},
            "ftprootdir": "results",
            "last_clean_date": "",
            "updatehome": "192.168.201.1",
            "ftpserver": "192.168.201.1",
            "comments": "This is a model PGM.  Do not delete.",
            "last_experiment": "",
            "ftppassword": "ionguest",
            "updateflag": false,
            "location": {
                "name": "Home",
                "resource_uri": "/rundb/api/v1/location/1/",
                "defaultlocation": true,
                "comments": "",
                "id": 1
            },
            "last_init_date": "",
            "updateCommand": {},
            "alarms": {},
            "serial": null,
            "host_address": "",
            "type": "",
            "ftpusername": "ionguest",
            "resource_uri": "/rundb/api/v1/rig/default/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Run Type Resource

Resource URL http://mytorrentserver/rundb/api/v1/runtype/
Schema URL http://mytorrentserver/rundb/api/v1/runtype/schema/

Resource Fields
field help text default nullable readonly blank unique type
applicationGroups Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false false false related
description Unicode string data. Ex: “Hello World”   false false true false string
nucleotideType Unicode string data. Ex: “Hello World” dna false false true false string
barcode Unicode string data. Ex: “Hello World”   false false true false string
meta Unicode string data. Ex: “Hello World”   true false false false string
alternate_name Unicode string data. Ex: “Hello World”   true false false false string
runType Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
isActive Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 15,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/runtype/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "applicationGroups": [
                "/rundb/api/v1/applicationgroup/1/",
                "/rundb/api/v1/applicationgroup/3/",
                "/rundb/api/v1/applicationgroup/4/"
            ],
            "description": "Generic Sequencing",
            "nucleotideType": "dna",
            "barcode": "",
            "meta": {},
            "alternate_name": "Other",
            "runType": "GENS",
            "id": 1,
            "isActive": true,
            "resource_uri": "/rundb/api/v1/runtype/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Resource

Resource URL http://mytorrentserver/rundb/api/v1/sample/
Schema URL http://mytorrentserver/rundb/api/v1/sample/schema/

Resource Fields
field help text default nullable readonly blank unique type
status Unicode string data. Ex: “Hello World”   false false true false string
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
description Unicode string data. Ex: “Hello World” n/a true false false false string
displayedName Unicode string data. Ex: “Hello World” n/a true false false false string
experiments Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
externalId Unicode string data. Ex: “Hello World”   true false false false string
date A date & time as a string. Ex: “2010-11-10T03:07:43” true true false false false datetime
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
id Integer data. Ex: 2673   false false true true integer
name Unicode string data. Ex: “Hello World” n/a true false false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 23,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/sample/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "status": "run",
            "sampleSets": [],
            "description": null,
            "displayedName": "e5272-wfa-l165",
            "experiments": [
                "/rundb/api/v1/experiment/94/"
            ],
            "externalId": "",
            "date": "2017-08-23T21:42:01.000299+00:00",
            "resource_uri": "/rundb/api/v1/sample/4/",
            "id": 4,
            "name": "e5272-wfa-l165"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
Allowed detail HTTP methods
  • GET
  • POST
  • PUT

Sample Annotation Cv Resource

Resource URL http://mytorrentserver/rundb/api/v1/sampleannotation_cv/
Schema URL http://mytorrentserver/rundb/api/v1/sampleannotation_cv/schema/

Resource Fields
field help text default nullable readonly blank unique type
annotationType Unicode string data. Ex: “Hello World” n/a false false false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
isIRCompatible Boolean data. Ex: True false false false true false boolean
sampleGroupType_CV A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
value Unicode string data. Ex: “Hello World”   false false true false string
iRValue Unicode string data. Ex: “Hello World” n/a true false false false string
iRAnnotationType Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
isActive Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 50,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/sampleannotation_cv/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "annotationType": "relationshipRole",
            "uid": "SAMPLEANNOTATE_CV_0006",
            "isIRCompatible": true,
            "sampleGroupType_CV": "/rundb/api/v1/samplegrouptype_cv/4/",
            "value": "Father",
            "iRValue": "Father",
            "iRAnnotationType": "Relation",
            "id": 6,
            "isActive": true,
            "resource_uri": "/rundb/api/v1/sampleannotation_cv/6/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Attribute Resource

Resource URL http://mytorrentserver/rundb/api/v1/sampleattribute/
Schema URL http://mytorrentserver/rundb/api/v1/sampleattribute/schema/

Resource Fields
field help text default nullable readonly blank unique type
description Unicode string data. Ex: “Hello World” n/a true false false false string
dataType_name Unicode string data. Ex: “Hello World” n/a true true true false string
dataType A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
displayedName Unicode string data. Ex: “Hello World” n/a false false false true string
isMandatory Boolean data. Ex: True false false false true false boolean
sampleCount Integer data. Ex: 2673 n/a false true false false integer
lastModifiedDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
creationDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
id Integer data. Ex: 2673   false false true true integer
isActive Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Attribute Data Type Resource

Resource URL http://mytorrentserver/rundb/api/v1/sampleattributedatatype/
Schema URL http://mytorrentserver/rundb/api/v1/sampleattributedatatype/schema/

Resource Fields
field help text default nullable readonly blank unique type
dataType Unicode string data. Ex: “Hello World” n/a false false false true string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
description Unicode string data. Ex: “Hello World” n/a true false false false string
isActive Boolean data. Ex: True true false false true false boolean
id Integer data. Ex: 2673   false false true true integer
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/sampleattributedatatype/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "dataType": "Text",
            "resource_uri": "/rundb/api/v1/sampleattributedatatype/1/",
            "description": "Up to 1024 characters",
            "isActive": true,
            "id": 1
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Group Type Cv Resource

Resource URL http://mytorrentserver/rundb/api/v1/samplegrouptype_cv/
Schema URL http://mytorrentserver/rundb/api/v1/samplegrouptype_cv/schema/

Resource Fields
field help text default nullable readonly blank unique type
isIRCompatible Boolean data. Ex: True false false false true false boolean
description Unicode string data. Ex: “Hello World” n/a true false false false string
sampleAnnotation_set Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
displayedName Unicode string data. Ex: “Hello World” n/a false false false true string
iRValue Unicode string data. Ex: “Hello World” n/a true false false false string
iRAnnotationType Unicode string data. Ex: “Hello World” n/a true false false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
sampleSets Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
id Integer data. Ex: 2673   false false true true integer
isActive Boolean data. Ex: True true false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 7,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/samplegrouptype_cv/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isIRCompatible": true,
            "description": "",
            "sampleAnnotation_set": [
                "/rundb/api/v1/sampleannotation_cv/1/",
                "/rundb/api/v1/sampleannotation_cv/2/"
            ],
            "displayedName": "Sample_Control",
            "iRValue": "Paired_Sample|Sample_Control",
            "iRAnnotationType": "RelationshipType",
            "uid": "SAMPLEGROUP_CV_0001",
            "sampleSets": [],
            "id": 1,
            "isActive": true,
            "resource_uri": "/rundb/api/v1/samplegrouptype_cv/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Prep Data Resource

Resource URL http://mytorrentserver/rundb/api/v1/sampleprepdata/
Schema URL http://mytorrentserver/rundb/api/v1/sampleprepdata/schema/

Resource Fields
field help text default nullable readonly blank unique type
instrumentName Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World”   false false true false string
tipRackBarcode Unicode string data. Ex: “Hello World”   false false true false string
remainingSeconds Integer data. Ex: 2673 n/a true false false false integer
reagentsExpiration Unicode string data. Ex: “Hello World”   false false true false string
instrumentStatus Unicode string data. Ex: “Hello World”   false false true false string
solutionsExpiration Unicode string data. Ex: “Hello World”   false false true false string
message Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
reagentsPart Unicode string data. Ex: “Hello World”   false false true false string
packageVer Unicode string data. Ex: “Hello World”   false false true false string
progress Floating point numeric data. Ex: 26.73 0 false false true false float
lastUpdate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
logPath Unicode string data. Ex: “Hello World” n/a true false false false string
solutionsLot Unicode string data. Ex: “Hello World”   false false true false string
scriptVersion Unicode string data. Ex: “Hello World”   false false true false string
startTime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
operationMode Unicode string data. Ex: “Hello World”   false false true false string
samplePrepDataType Unicode string data. Ex: “Hello World”   false false true false string
solutionsPart Unicode string data. Ex: “Hello World”   false false true false string
reagentsLot Unicode string data. Ex: “Hello World”   false false true false string
endTime A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Set Resource

Resource URL http://mytorrentserver/rundb/api/v1/sampleset/
Schema URL http://mytorrentserver/rundb/api/v1/sampleset/schema/

Resource Fields
field help text default nullable readonly blank unique type
status Unicode string data. Ex: “Hello World”   false false true false string
libraryPrepInstrument Unicode string data. Ex: “Hello World”   false false true false string
libraryPrepType Unicode string data. Ex: “Hello World”   false false true false string
libraryPrepPlateType Unicode string data. Ex: “Hello World”   false false true false string
description Unicode string data. Ex: “Hello World” n/a true false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
sampleCount Integer data. Ex: 2673 n/a false true false false integer
displayedName Unicode string data. Ex: “Hello World” n/a false false false true string
SampleGroupType_CV A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
pcrPlateSerialNum Unicode string data. Ex: “Hello World”   true false false false string
libraryPrepInstrumentData A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
libraryPrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
samples Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
lastModifiedDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
sampleGroupTypeName Unicode string data. Ex: “Hello World” n/a true true true false string
combinedLibraryTubeLabel Unicode string data. Ex: “Hello World”   false false true false string
creationDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
libraryPrepTypeDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
id Integer data. Ex: 2673   false false true true integer
libraryPrepKitDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 2,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/sampleset/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "readyForPlanning": true,
            "status": "created",
            "libraryPrepInstrument": "",
            "libraryPrepType": "",
            "libraryPrepPlateType": "",
            "description": "",
            "resource_uri": "/rundb/api/v1/sampleset/1/",
            "sampleCount": 8,
            "displayedName": "Ampliseq on Chef",
            "SampleGroupType_CV": null,
            "pcrPlateSerialNum": "",
            "libraryPrepInstrumentData": null,
            "libraryPrepKitName": "",
            "samples": [
                "/rundb/api/v1/samplesetitem/3/",
                "/rundb/api/v1/samplesetitem/5/",
                "/rundb/api/v1/samplesetitem/7/",
                "/rundb/api/v1/samplesetitem/9/",
                "/rundb/api/v1/samplesetitem/11/",
                "/rundb/api/v1/samplesetitem/13/",
                "/rundb/api/v1/samplesetitem/15/",
                "/rundb/api/v1/samplesetitem/17/"
            ],
            "lastModifiedDate": "2017-08-28T21:21:14.000027+00:00",
            "sampleGroupTypeName": "",
            "combinedLibraryTubeLabel": "",
            "creationDate": "2017-08-28T21:21:14.000027+00:00",
            "libraryPrepTypeDisplayedName": "",
            "id": 1,
            "libraryPrepKitDisplayedName": ""
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Set Item Resource

Resource URL http://mytorrentserver/rundb/api/v1/samplesetitem/
Schema URL http://mytorrentserver/rundb/api/v1/samplesetitem/schema/

Resource Fields
field help text default nullable readonly blank unique type
sample A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
cellNum Unicode string data. Ex: “Hello World”   true false false false string
biopsyDays Integer data. Ex: 2673 0 true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
gender Unicode string data. Ex: “Hello World” n/a true false false false string
relationshipGroup Integer data. Ex: 2673 n/a false false false false integer
coupleId Unicode string data. Ex: “Hello World”   true false false false string
cellularityPct Integer data. Ex: 2673 n/a true false false false integer
id Integer data. Ex: 2673   false false true true integer
relationshipRole Unicode string data. Ex: “Hello World” n/a true false false false string
pcrPlateColumn Unicode string data. Ex: “Hello World”   true false false false string
cancerType Unicode string data. Ex: “Hello World” n/a true false false false string
controlType Unicode string data. Ex: “Hello World”   true false false false string
sampleSet A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
lastModifiedDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
dnabarcode A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
pcrPlateRow Unicode string data. Ex: “Hello World”   true false false false string
creationDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
embryoId Unicode string data. Ex: “Hello World”   true false false false string
description Unicode string data. Ex: “Hello World”   true false false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 16,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/samplesetitem/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "sample": "/rundb/api/v1/sample/8/",
            "cellNum": "",
            "biopsyDays": 0,
            "resource_uri": "/rundb/api/v1/samplesetitem/3/",
            "nucleotideType": "",
            "gender": "",
            "relationshipGroup": 0,
            "coupleId": "",
            "cellularityPct": null,
            "id": 3,
            "relationshipRole": "",
            "pcrPlateColumn": "",
            "cancerType": "",
            "controlType": "",
            "sampleSet": "/rundb/api/v1/sampleset/1/",
            "lastModifiedDate": "2017-11-01T16:19:12.000420+00:00",
            "dnabarcode": null,
            "pcrPlateRow": "",
            "creationDate": "2017-11-01T16:19:12.000420+00:00",
            "embryoId": "",
            "description": ""
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sample Set Item Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/samplesetiteminfo/
Schema URL http://mytorrentserver/rundb/api/v1/samplesetiteminfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
relationshipGroup Integer data. Ex: 2673 n/a true true true false integer
sampleDescription Unicode string data. Ex: “Hello World” n/a true true true false string
dnabarcodeKit Unicode string data. Ex: “Hello World” n/a true true true false string
sample A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
pcrPlateColumn Unicode string data. Ex: “Hello World”   true false false false string
cancerType Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
sampleDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
cellNum Unicode string data. Ex: “Hello World”   true false false false string
sampleExternalId Unicode string data. Ex: “Hello World” n/a true true true false string
coupleId Unicode string data. Ex: “Hello World”   true false false false string
pcrPlateRow Unicode string data. Ex: “Hello World”   true false false false string
sampleSetPk Integer data. Ex: 2673 n/a true true true false integer
sampleSetStatus Unicode string data. Ex: “Hello World” n/a true true true false string
embryoId Unicode string data. Ex: “Hello World”   true false false false string
sampleSet A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
description Unicode string data. Ex: “Hello World”   true false false false string
lastModifiedDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
relationshipRole Unicode string data. Ex: “Hello World” n/a true true true false string
samplePk Integer data. Ex: 2673 n/a true true true false integer
dnabarcode A single related resource. Can be either a URI or set of nested resource data. n/a true true true false related
creationDate A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
biopsyDays Integer data. Ex: 2673 0 true false false false integer
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
gender Unicode string data. Ex: “Hello World” n/a true false false false string
cellularityPct Integer data. Ex: 2673 n/a true false false false integer
controlType Unicode string data. Ex: “Hello World”   true false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 16,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/samplesetiteminfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "relationshipGroup": 0,
            "sampleDescription": "",
            "dnabarcodeKit": "",
            "sample": "/rundb/api/v1/sample/8/",
            "pcrPlateColumn": "",
            "cancerType": "",
            "attribute_dict": {},
            "id": 3,
            "sampleDisplayedName": "1",
            "cellNum": "",
            "sampleExternalId": "",
            "coupleId": "",
            "pcrPlateRow": "",
            "sampleSetPk": 1,
            "sampleSetStatus": "created",
            "embryoId": "",
            "sampleSet": "/rundb/api/v1/sampleset/1/",
            "description": "",
            "lastModifiedDate": "2017-11-01T16:19:12.000420+00:00",
            "sampleSetGroupType": "",
            "relationshipRole": "",
            "samplePk": 8,
            "dnabarcode": "",
            "creationDate": "2017-11-01T16:19:12.000420+00:00",
            "biopsyDays": 0,
            "nucleotideType": "",
            "gender": "",
            "cellularityPct": null,
            "controlType": "",
            "resource_uri": "/rundb/api/v1/samplesetiteminfo/3/"
        }
    ]
}
Allowed list HTTP methods
  • GET
Allowed detail HTTP methods
  • GET

Sequencing Kit Info Resource

Resource URL http://mytorrentserver/rundb/api/v1/sequencingkitinfo/
Schema URL http://mytorrentserver/rundb/api/v1/sequencingkitinfo/schema/

Resource Fields
field help text default nullable readonly blank unique type
isActive Boolean data. Ex: True true false false true false boolean
samplePrep_instrumentType Unicode string data. Ex: “Hello World”   false false true false string
kitType Unicode string data. Ex: “Hello World” n/a false false false false string
defaultFlowOrder A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
name Unicode string data. Ex: “Hello World” n/a false false false true string
nucleotideType Unicode string data. Ex: “Hello World”   false false true false string
defaultCartridgeUsageCount Integer data. Ex: 2673 n/a true false false false integer
instrumentType Unicode string data. Ex: “Hello World”   false false true false string
chipTypes Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
parts Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a false false false false related
flowCount Integer data. Ex: 2673 n/a false false false false integer
applicationType Unicode string data. Ex: “Hello World”   true false false false string
cartridgeExpirationDayLimit Integer data. Ex: 2673 n/a true false false false integer
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
cartridgeBetweenUsageAbsoluteMaxDayLimit Integer data. Ex: 2673 n/a true false false false integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
uid Unicode string data. Ex: “Hello World” n/a false false false true string
id Integer data. Ex: 2673   false false true true integer
categories Unicode string data. Ex: “Hello World”   true false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 28,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/sequencingkitinfo/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isActive": true,
            "samplePrep_instrumentType": "OT_IC",
            "kitType": "SequencingKit",
            "defaultFlowOrder": null,
            "name": "IonPGMInstallKit",
            "nucleotideType": "",
            "defaultCartridgeUsageCount": null,
            "instrumentType": "pgm",
            "chipTypes": "",
            "runMode": "",
            "parts": [
                {
                    "barcode": "4480217",
                    "id": 20019,
                    "resource_uri": "/rundb/api/v1/kitpart/20019/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                },
                {
                    "barcode": "4480282",
                    "id": 20020,
                    "resource_uri": "/rundb/api/v1/kitpart/20020/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                },
                {
                    "barcode": "4480284",
                    "id": 20021,
                    "resource_uri": "/rundb/api/v1/kitpart/20021/",
                    "kit": "/rundb/api/v1/kitinfo/20020/"
                }
            ],
            "flowCount": 100,
            "applicationType": "",
            "cartridgeExpirationDayLimit": null,
            "libraryReadLength": 0,
            "cartridgeBetweenUsageAbsoluteMaxDayLimit": null,
            "resource_uri": "/rundb/api/v1/sequencingkitinfo/20020/",
            "uid": "SEQ0006",
            "id": 20020,
            "categories": "readLengthDerivableFromFlows;",
            "description": "Ion PGM Install Kit"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Sequencing Kit Part Resource

Resource URL http://mytorrentserver/rundb/api/v1/sequencingkitpart/
Schema URL http://mytorrentserver/rundb/api/v1/sequencingkitpart/schema/

Resource Fields
field help text default nullable readonly blank unique type
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
barcode Unicode string data. Ex: “Hello World” n/a false false false true string
defaultFlowOrder A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
kit A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
id Integer data. Ex: 2673   false false true true integer
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 104,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/sequencingkitpart/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "resource_uri": "/rundb/api/v1/sequencingkitpart/20021/",
            "barcode": "4480284",
            "defaultFlowOrder": null,
            "kit": "/rundb/api/v1/kitinfo/20020/",
            "id": 20021
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Support Upload Resource

Resource URL http://mytorrentserver/rundb/api/v1/supportupload/
Schema URL http://mytorrentserver/rundb/api/v1/supportupload/schema/

Resource Fields
field help text default nullable readonly blank unique type
ticket_id Unicode string data. Ex: “Hello World”   false false true false string
updated A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
local_message Unicode string data. Ex: “Hello World”   false false true false string
description Unicode string data. Ex: “Hello World”   false false false false string
created A date & time as a string. Ex: “2010-11-10T03:07:43” true false false true false datetime
ticket_status Unicode string data. Ex: “Hello World”   false false true false string
contact_email Unicode string data. Ex: “Hello World”   false false false false string
result A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
file A single related resource. Can be either a URI or set of nested resource data. n/a true false false false related
celery_task_id Unicode string data. Ex: “Hello World”   false false true false string
ticket_message Unicode string data. Ex: “Hello World”   false false true false string
id Integer data. Ex: 2673   false false true true integer
local_status Unicode string data. Ex: “Hello World”   false false true false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 0,
        "offset": 0,
        "limit": 1,
        "next": null
    },
    "objects": []
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Template Resource

Resource URL http://mytorrentserver/rundb/api/v1/template/
Schema URL http://mytorrentserver/rundb/api/v1/template/schema/

Resource Fields
field help text default nullable readonly blank unique type
isofficial Boolean data. Ex: True true false false true false boolean
name Unicode string data. Ex: “Hello World” n/a false false false false string
sequence Unicode string data. Ex: “Hello World”   false false true false string
comments Unicode string data. Ex: “Hello World”   false false true false string
key Unicode string data. Ex: “Hello World” n/a false false false false string
id Integer data. Ex: 2673   false false true true integer
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 6,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/template/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "isofficial": true,
            "name": "TF_A",
            "sequence": "TGTTTTAGGGTCCCCGGGGTTAAAAGGTTTCGAACTCAACAGCTGTCTGGCAGCTCGCTCTACGATCTGAGACTGCCAAGGCACACAGGGGATAGG",
            "comments": " ",
            "key": "ATCG",
            "id": 1,
            "resource_uri": "/rundb/api/v1/template/1/"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Tf Metrics Resource

Resource URL http://mytorrentserver/rundb/api/v1/tfmetrics/
Schema URL http://mytorrentserver/rundb/api/v1/tfmetrics/schema/

Resource Fields
field help text default nullable readonly blank unique type
corrHPSNR Unicode string data. Ex: “Hello World”   false false true false string
Q10Mean Floating point numeric data. Ex: 26.73 n/a false false false false float
SysSNR Floating point numeric data. Ex: 26.73 n/a false false false false float
HPAccuracy Unicode string data. Ex: “Hello World”   false false true false string
Q17ReadCount Floating point numeric data. Ex: 26.73 n/a false false false false float
sequence Unicode string data. Ex: “Hello World” n/a false false false false string
Q17Histo Unicode string data. Ex: “Hello World”   false false true false string
name Unicode string data. Ex: “Hello World” n/a false false false false string
aveKeyCount Floating point numeric data. Ex: 26.73 n/a false false false false float
number Floating point numeric data. Ex: 26.73 n/a false false false false float
id Integer data. Ex: 2673   false false true true integer
keypass Floating point numeric data. Ex: 26.73 n/a false false false false float
Q10ReadCount Floating point numeric data. Ex: 26.73 n/a false false false false float
report A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Q17Mean Floating point numeric data. Ex: 26.73 n/a false false false false float
Q10Histo Unicode string data. Ex: “Hello World”   false false true false string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 10,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/tfmetrics/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "corrHPSNR": "",
            "Q10Mean": 92,
            "SysSNR": 8.90596237826753,
            "HPAccuracy": "0 : 92614661/92987980, 1 : 66459432/67074439, 2 : 2982150/3047963, 3 : 0/0, 4 : 701514/761937, 5 : 0/0, 6 : 0/0, 7 : 0/0",
            "Q17ReadCount": 663166,
            "sequence": "TACGAGCGTGTAGACGTGTCGTACGTGCGACGTAGTGAGTATACATGCTCTGACACTATGTACGATCTGAGACTGCCAAGGCACACAGGGGATAGG",
            "Q17Histo": "6186 2376 12408 3441 8 196 6739 944 62 3088 1321 1740 5837 11552 5171 6973 3499 3109 2311 5441 1418 861 889 476 632 693 1993 587 208 2048 844 951 799 535 202 53 989 443 213 222 160 499 378 235 56 39 90 71 81 57 2773 919 753 845 411 2087 578 481 895 330 492 337 365 1146 474 624 457 442 282 657 888 422 270 290 412 457 1321 78 431 97 612 84 734 210 135 550 274 1025 151 1225 20936 9776 1625 338 780 18329 551335 35033 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0",
            "name": "TF_C",
            "aveKeyCount": 95,
            "number": 762290,
            "id": 1,
            "keypass": 762290,
            "Q10ReadCount": 732661,
            "report": "/rundb/api/v1/results/3/",
            "resource_uri": "/rundb/api/v1/tfmetrics/1/",
            "Q17Mean": 83,
            "Q10Histo": "1963 514 2070 833 2 15 20 52 29 47 959 452 1823 2178 2099 2088 1338 678 623 514 695 769 435 231 218 209 304 449 377 132 307 482 698 667 494 262 254 250 389 312 653 356 312 392 457 376 233 206 171 242 355 428 368 376 328 274 160 128 127 117 208 147 128 140 112 122 101 86 101 116 167 130 137 107 110 134 188 165 147 120 189 174 179 153 208 284 358 416 548 1770 22262 10956 4925 3780 3745 21341 555735 39369 18315 11400 8819 7006 5487 4258 3206 1865 586 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Three Prime Adapter Resource

Resource URL http://mytorrentserver/rundb/api/v1/threeprimeadapter/
Schema URL http://mytorrentserver/rundb/api/v1/threeprimeadapter/schema/

Resource Fields
field help text default nullable readonly blank unique type
direction Unicode string data. Ex: “Hello World” Forward false false false false string
description Unicode string data. Ex: “Hello World”   false false true false string
sequence Unicode string data. Ex: “Hello World” n/a false false false false string
chemistryType Unicode string data. Ex: “Hello World”   false false true false string
runMode Unicode string data. Ex: “Hello World” single false false true false string
isActive Boolean data. Ex: True true false false true false boolean
uid Unicode string data. Ex: “Hello World” n/a false false false true string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
id Integer data. Ex: 2673   false false true true integer
isDefault Boolean data. Ex: True false false false true false boolean
name Unicode string data. Ex: “Hello World” n/a false false false true string
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 8,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/threeprimeadapter/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "direction": "Forward",
            "description": "Default forward adapter",
            "sequence": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
            "chemistryType": "",
            "runMode": "single",
            "isActive": true,
            "uid": "FWD_0001",
            "resource_uri": "/rundb/api/v1/threeprimeadapter/1/",
            "id": 1,
            "isDefault": true,
            "name": "Ion P1B"
        }
    ]
}
Allowed list HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH
Allowed detail HTTP methods
  • GET
  • POST
  • PUT
  • DELETE
  • PATCH

Torrent Suite Resource

Resource URL http://mytorrentserver/rundb/api/v1/torrentsuite/
Schema URL http://mytorrentserver/rundb/api/v1/torrentsuite/schema/

Resource Fields
field help text default nullable readonly blank unique type
meta_version Unicode string data. Ex: “Hello World” n/a true true true false string
locked Unicode string data. Ex: “Hello World” n/a true true true false boolean
logs Unicode string data. Ex: “Hello World” n/a true true true false boolean
versions Unicode string data. Ex: “Hello World” n/a true true true false string
Example Response
{
    "meta_version": "5.10.0",
    "locked": false,
    "logs": false,
    "versions": {
        "ion-docs": "5.10.2",
        "ion-gpu": "5.10.0-1",
        "ion-pipeline": "5.10.8-1",
        "ion-torrentpy": "5.10.8-1",
        "ion-tsconfig": "5.10.4-1",
        "ion-chefupdates": "5.10.0",
        "ion-rsmts": "5.6.1-1",
        "ion-sampledata": "1.2.0-1",
        "ion-publishers": "5.10.2-1",
        "ion-dbreports": "5.10.26-1",
        "ion-analysis": "5.10.10-1",
        "ion-onetouchupdater": "5.0.2-1",
        "ion-torrentr": "5.10.9-1",
        "ion-plugins": "5.10.12-1",
        "ion-referencelibrary": "2.2.0"
    }
}
Allowed list HTTP methods
  • GET
  • PUT
Allowed detail HTTP methods

None

User Resource

Resource URL http://mytorrentserver/rundb/api/v1/user/
Schema URL http://mytorrentserver/rundb/api/v1/user/schema/

Resource Fields
field help text default nullable readonly blank unique type
profile A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
username Required. 30 characters or fewer. Letters, numbers and @/./+/-/_ characters n/a false false false true string
first_name Unicode string data. Ex: “Hello World”   false false true false string
last_name Unicode string data. Ex: “Hello World”   false false true false string
is_active Designates whether this user should be treated as active. Unselect this instead of deleting accounts. true false false true false boolean
email Unicode string data. Ex: “Hello World”   false false true false string
last_login A date & time as a string. Ex: “2010-11-10T03:07:43” 2018-06-19T20:40:18.000722+00:00 false false false false datetime
full_name Unicode string data. Ex: “Hello World” n/a false false false false string
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
id Integer data. Ex: 2673   false false true true integer
date_joined A date & time as a string. Ex: “2010-11-10T03:07:43” 2018-06-19T20:40:18.000722+00:00 false false false false datetime
Example Response
{
    "meta": {
        "previous": null,
        "total_count": 6,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/user/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "profile": {
                "phone_number": "",
                "name": "",
                "title": "Lab Contact",
                "last_read_news_post": "1984-11-06T00:00:00+00:00",
                "note": "",
                "id": 3,
                "resource_uri": ""
            },
            "username": "lab_contact",
            "first_name": "",
            "last_name": "",
            "is_active": true,
            "email": "ionuser@iontorrent.com",
            "last_login": "2017-07-22T06:43:37.000251+00:00",
            "full_name": "",
            "resource_uri": "/rundb/api/v1/user/3/",
            "id": 3,
            "date_joined": "2017-07-22T06:43:37.000251+00:00"
        }
    ]
}
Allowed list HTTP methods
  • GET
Allowed detail HTTP methods
  • GET

API Examples

See API Reference for a listing of all available APIs. This section has the setup common to all the API examples. See Authentication for more information on the authentication header. All examples use the third-party python library requests.

import requests

BASE_URL = "http://example.xyz"
USERNAME = "ionadmin"
API_KEY = "efb7a14021732d773a4258b69d9452042a31a6b6"

Fetching all Chips

Using the Chip Resource API.

headers = {"Authorization": "ApiKey " + USERNAME + ":" + API_KEY}
object_list = []

next_url = "/rundb/api/v1/chip/"
while next_url:
    response = requests.get(BASE_URL + next_url, headers=headers, params={})
    response.raise_for_status()
    response_data = response.json()

    object_list += response_data["objects"]
    next_url = response_data["meta"]["next"] or None

print object_list

[...]

Adding Filters

Using the Chip Resource API.

headers = {"Authorization": "ApiKey " + USERNAME + ":" + API_KEY}
object_list = []

next_url = "/rundb/api/v1/chip/"
while next_url:
    response = requests.get(BASE_URL + next_url, headers=headers, params={"name__startswith": "31"})
    response.raise_for_status()
    response_data = response.json()

    object_list += response_data["objects"]
    next_url = response_data["meta"]["next"] or None

for chip in object_list[0:3]:
    print chip["name"]

314
316
318

Completed Runs and Reports

Using the Composite Experiment Resource API.

headers = {"Authorization": "ApiKey " + USERNAME + ":" + API_KEY}
object_list = []

next_url = "/rundb/api/v1/compositeexperiment/"
while next_url:
    response = requests.get(BASE_URL + next_url, headers=headers)
    response.raise_for_status()
    response_data = response.json()

    object_list += response_data["objects"]
    next_url = response_data["meta"]["next"] or None

for experiment in object_list[0:3]:
    print experiment["displayName"]
    for report in experiment["results"]:
        print "    " + report["resultsName"] + " " + report["status"]

S5-530 cfDNA
    Reanalyze Completed
    S5-530_cfDNA Completed
    Auto_S5-530_cfDNA_89 Completed
S5-540 AmpliSeqExome
    S5-540_AmpliSeqExome Importing Failed
    Auto_S5-540_AmpliSeqExome_90 Completed
S5-540 WholeTranscriptomeRNA
    Auto_S5-540_WholeTranscriptomeRNA_91 Importing Failed

Fetching a Report

Using the Results Resource API.

headers = {"Authorization": "ApiKey " + USERNAME + ":" + API_KEY}

report_response = requests.get(BASE_URL + "/rundb/api/v1/results/3/", headers=headers)
report_response.raise_for_status()
report_response_data = report_response.json()

print report_response_data["resultsName"]

for plugin_name, plugin_status in report_response_data["pluginState"].items():
    print "    " + plugin_name, plugin_status

lib_metrics_response = requests.get(BASE_URL + report_response_data["libmetrics"][0], headers=headers)
lib_metrics_response.raise_for_status()
lib_metrics_response_data = lib_metrics_response.json()

print "%.1f million reads" % (lib_metrics_response_data["totalNumReads"]/1000000.0)

Auto_S5-540_WholeTranscriptomeRNA_91
    DataExport Completed
    ERCC_Analysis Completed
    sampleID Error
    coverageAnalysis Error
    AssemblerSPAdes Started
    FilterDuplicates Completed
    RunTransfer Completed
94.0 million reads

Planning a Non-barcoded Run

Using the Planned Experiment Resource API.

headers = {"Authorization": "ApiKey " + USERNAME + ":" + API_KEY}
plan_json = {
    "library": "hg19",
    "planName": "DOCS_my_plan",
    "sample": "my_sample",
    "chipType": "520",
    "sequencekitname": "Ion S5 Sequencing Kit",
    "librarykitname": "Ion Xpress Plus Fragment Library Kit",
    "templatingKitName": "Ion 520/530 Kit-OT2"
}
response = requests.post(BASE_URL + "/rundb/api/v1/plannedexperiment/", headers=headers, json=plan_json)
response.raise_for_status()
print response.status_code

201

Planning a Barcoded Run

Using the Planned Experiment Resource API.

headers = {"Authorization": "ApiKey " + USERNAME + ":" + API_KEY}
plan_json = {
    "library": "hg19",
    "planName": "DOCS_my_plan",
    "sample": "my_sample",
    "chipType": "520",
    "sequencekitname": "Ion S5 Sequencing Kit",
    "librarykitname": "Ion Xpress Plus Fragment Library Kit",
    "templatingKitName": "Ion 520/530 Kit-OT2",
    "barcodeId": "IonXpress",
    "barcodedSamples": {
        'demo sample 1': {
            'barcodeSampleInfo': {
                'IonXpress_003': {
                    'description': 'description here',
                    'hotSpotRegionBedFile': '',
                    'nucleotideType': 'DNA',
                    'reference': 'hg19',
                    'targetRegionBedFile': ''
                }
            },
            'barcodes': ['IonXpress_003']
        },
        'demo sample 2': {
            'barcodeSampleInfo': {
                'IonXpress_004': {
                    'description': 'description here',
                    'hotSpotRegionBedFile': '',
                    'nucleotideType': 'DNA',
                    'reference': 'hg19',
                    'targetRegionBedFile': ''
                }
            },
            'barcodes': ['IonXpress_004']
        }
    }
}
response = requests.post(BASE_URL + "/rundb/api/v1/plannedexperiment/", headers=headers, json=plan_json)
response.raise_for_status()
print response.status_code

201